Difference between revisions of "Part:BBa K5267043"
| Line 27: | Line 27: | ||
At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1]. | At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1]. | ||
<br>We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1) | <br>We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1) | ||
| − | <br>The system is divided into two parts: the signal response element (encoded by [[Part: BBa_ K5267007]]) and the detection report element (encoded by [ | + | <br>The system is divided into two parts: the signal response element (encoded by [[Part: BBa_ K5267007]]) and the detection report element (encoded by [https://parts.igem.org/Part:BBa_K2728003 Part:BBa_K2728003]). |
<br>HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway. | <br>HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway. | ||
<html> | <html> | ||
Revision as of 09:56, 28 September 2024
P_1xNFAT->IgK->Nluc->bGH_polyA
Transpose and respond to calcium ion signals Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 190
- 1000COMPATIBLE WITH RFC[1000]
Profile
Name: P_1*NFAT->IgK->Nluc->bGH_polyA
Base Pairs: 1067bp
Origin: Homo sapiens
Properties: The transformation of calcium ion concentration is reported by fluorescence
Usage and Biology
At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1].
In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. (Figure 2)
In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
Top:
[1] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1)
The system is divided into two parts: the signal response element (encoded by Part: BBa_ K5267007) and the detection report element (encoded by Part:BBa_K2728003).
HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway.
Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed Nanoluc reporter system.
Special design
These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. (Figure 1)
To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]
Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.
Function test
In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
Sequence
ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
ggtatataatggaagctcgacttccagtact
Reference
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.