Difference between revisions of "Part:BBa K5317021"
(→Sequence and features) |
(→Cloning) |
||
| Line 75: | Line 75: | ||
</html> | </html> | ||
| + | ===Sequence and features=== | ||
| + | <partinfo>BBa_K5317021 SequenceAndFeatures</partinfo> | ||
===Cloning=== | ===Cloning=== | ||
Furthermore, the CMV promoter ensures robust | Furthermore, the CMV promoter ensures robust | ||
| − | expression in mammalian systems (Radhakrishnan ''et al.'', 2008) that can be easily detected and analysed. This composite part was engineered with NEBBuilder® HIFI assembly method. We linearized eGFP-C2 with BamHI and AseI inserting a linked ATF2 and mRuby seamlessly. | + | expression in mammalian systems (Radhakrishnan ''et al.'', 2008) that can be easily detected and analysed. This composite part was engineered with NEBBuilder® HIFI assembly method. We linearized eGFP-C2 with BamHI and AseI inserting a linked ATF2 and mRuby seamlessly. |
=Characterisation= | =Characterisation= | ||
Revision as of 16:55, 27 September 2024
CMV-ATF2-mRuby2
Usage and Biology
ATF2 belongs to the ATF/CREB family (Kirsch et al., 2020) and its phosphorylation by PknB, making it important for research into signaling pathways related to cell stress and survival, while mRuby2 provides a fluorescent marker for visualisation. In our cell-based & #946;-lactam ring-containing antibiotics sensor, ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of the ATF2-3xCre2xAP1 promoter.
Cloning
Theoretical Part Design
We placed the mRuby2 fluorescent marker (K5317001) downstream behind ATF2 (K5317015). This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.
| Primer name | Sequence |
|---|---|
| ATF2_fw_1 | TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag |
| ATF2_rv_2 | ggatccccacttcctgagggctgtgac |
| ATF2_fw_3 | caggaagtggggatccaccggtcg |
| ATF2_rv_4 | TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc |
Sequence and features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 670
Illegal SapI.rc site found at 2408
Cloning
Furthermore, the CMV promoter ensures robust expression in mammalian systems (Radhakrishnan et al., 2008) that can be easily detected and analysed. This composite part was engineered with NEBBuilder® HIFI assembly method. We linearized eGFP-C2 with BamHI and AseI inserting a linked ATF2 and mRuby seamlessly.
Characterisation
References
Kirsch, K., Zeke, A., Tőke, O., Sok, P., Sethi, A., Sebő, A., Kumar, G. S., Egri, P., Póti, Á. L., Gooley, P., Peti, W., Bento, I., Alexa, A., & Reményi, A. (2020). Co-regulation of the transcription controlling ATF2 phosphoswitch by JNK and p38. Nature Communications, 11(1), 5769. https://doi.org/10.1038/s41467-020-19582-3
Radhakrishnan, P., Basma, H., Klinkebiel, D., Christman, J., & Cheng, P.-W. (2008). Cell type-specific activation of the cytomegalovirus promoter by dimethylsulfoxide and 5-Aza-2’-deoxycytidine. The International Journal of Biochemistry & Cell Biology, 40(9), 1944–1955. https://doi.org/10.1016/j.biocel.2008.02.014