Revision as of 16:46, 29 September 2024

Murine MTF-1 gene

Usage and Biology

The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez et al., 2019; Wimmer et al., 2005). Activation of MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters, and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez et al., 2019). Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H₂O₂, low extracellular pH (Saydam et al., 2001).

Cloning

Theoretical Part Design

This basic part contains the mammalian MTF-1 transcript, which was amplificated from murine fibroblast NIH3T3 cDNA by using the Primers in table 1.

HTML Table Caption Table1: Primers used to extract the MTF-1 gene sequence.

Primer name	Sequence
MTF1_fw	CAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGGGAACACAGTCCAGAC
MTF1_rv	gatcccccCTAGGGTGGCAGCTGCAG

Sequence and Features

Assembly Compatibility:

10
INCOMPATIBLE WITH RFC[10]
Illegal EcoRI site found at 1125
Illegal PstI site found at 370
Illegal PstI site found at 702
Illegal PstI site found at 1159
Illegal PstI site found at 1226
Illegal PstI site found at 1264
Illegal PstI site found at 1681
Illegal PstI site found at 2011
12
INCOMPATIBLE WITH RFC[12]
Illegal EcoRI site found at 1125
Illegal PstI site found at 370
Illegal PstI site found at 702
Illegal PstI site found at 1159
Illegal PstI site found at 1226
Illegal PstI site found at 1264
Illegal PstI site found at 1681
Illegal PstI site found at 2011
21
INCOMPATIBLE WITH RFC[21]
Illegal EcoRI site found at 1125
Illegal BamHI site found at 560
23
INCOMPATIBLE WITH RFC[23]
Illegal EcoRI site found at 1125
Illegal PstI site found at 370
Illegal PstI site found at 702
Illegal PstI site found at 1159
Illegal PstI site found at 1226
Illegal PstI site found at 1264
Illegal PstI site found at 1681
Illegal PstI site found at 2011
25
INCOMPATIBLE WITH RFC[25]
Illegal EcoRI site found at 1125
Illegal PstI site found at 370
Illegal PstI site found at 702
Illegal PstI site found at 1159
Illegal PstI site found at 1226
Illegal PstI site found at 1264
Illegal PstI site found at 1681
Illegal PstI site found at 2011
Illegal NgoMIV site found at 1939
1000
COMPATIBLE WITH RFC[1000]

Characterization

The correct MTF-1 functionality was analyzed by composing a gene cassette where its placed downstream of the constitutuve CMV promoter and fused with the reporter gene mRuby2 to assess the metal-dependent localization of MTF-1 based on the fluorescent signal. Please visit the K5317012 registry entry to view the results.

References

Saydam, N., Georgiev, O., Nakano, M. Y., Greber, U. F., & Schaffner, W. (2001). Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. The Journal of biological chemistry, 276(27), 25487–25495. https://doi.org/10.1074/jbc.M009154200

Tavera-Montañez, C., Hainer, S. J., Cangussu, D., Gordon, S. J. V., Xiao, Y., Reyes-Gutierrez, P., Imbalzano, A. N., Navea, J. G., Fazzio, T. G., & Padilla-Benavides, T. (2019). The classic metal-sensing transcription factor MTF1 promotes myogenesis in response to copper. FASEB journal: official publication of the Federation of American Societies for Experimental Biology, 33(12), 14556–14574. https://doi.org/10.1096/fj.201901606R

Wimmer, U., Wang, Y., Georgiev, O., & Schaffner, W. (2005). Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic acids research, 33(18), 5715–5727. https://doi.org/10.1093/nar/gki881

@@ Line 6: / Line 6: @@
 The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez ''et al.'', 2019; Wimmer ''et al.'', 2005).
 Activation of MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters, and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez ''et al.'', 2019).
-Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H2O2, low extracellular pH (Saydam ''et al.'', 2001).
+Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H<sub>2</sub>O<sub>2</sub>, low extracellular pH (Saydam ''et al.'', 2001).
 =Cloning=