Difference between revisions of "Part:BBa K5477000"

Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K5477000 short</partinfo>
 
<partinfo>BBa_K5477000 short</partinfo>
Line 5: Line 4:
 
RET2 is the delta subunit of the coatomer complex (COPI), which coats transport vesicles derived from the Golgi apparatus. It plays a key role in retrograde transport between the Golgi and endoplasmic reticulum (ER), ensuring proper protein and membrane trafficking within the cell (1).   
 
RET2 is the delta subunit of the coatomer complex (COPI), which coats transport vesicles derived from the Golgi apparatus. It plays a key role in retrograde transport between the Golgi and endoplasmic reticulum (ER), ensuring proper protein and membrane trafficking within the cell (1).   
  
<!--
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
 
From a paper of Lee et al. 2015, Figure 3A shows the relative strengths of 19 constitutive promoters by measuring fluorescence from two reporters, mRuby2 and Venus. From the data, pRET2 appears to be positioned in the medium-to-lower range of constitutive promoter strengths.
 
From a paper of Lee et al. 2015, Figure 3A shows the relative strengths of 19 constitutive promoters by measuring fluorescence from two reporters, mRuby2 and Venus. From the data, pRET2 appears to be positioned in the medium-to-lower range of constitutive promoter strengths.
  
[Figure here]
+
[[Image:YourTeamName_Figure1.png|600px|center|alt=Description of your image here]]
 
+
  
 
Figure 3A from Lee et al. 2015: The plot highlights three key promoters: pTDH3 (strong), pRPL18B (medium), and pREV1 (weak) (2). The horizontal and vertical bars represent the range of fluorescence from four biological replicates, with the intersection indicating the median. The inset also includes results from testing a third reporter, mTurquoise2, demonstrating consistent promoter strength across different reporter proteins.
 
Figure 3A from Lee et al. 2015: The plot highlights three key promoters: pTDH3 (strong), pRPL18B (medium), and pREV1 (weak) (2). The horizontal and vertical bars represent the range of fluorescence from four biological replicates, with the intersection indicating the median. The inset also includes results from testing a third reporter, mTurquoise2, demonstrating consistent promoter strength across different reporter proteins.
Line 16: Line 14:
 
In our system, pRET2 is used to drive the expression of our receptor modules – Aryl hydrocarbon receptor - AhR (particularly Aryl hydrocarbon receptor nuclear translocator - ARNT and Nuclear Receptor Coactivator- NCOA), LexA domain fused with ligand-binding domain of Estrogen Receptor alpha LexA-ERα, with Estrogen-related Receptor gamma ligand-binding domain LexA-ERRγ and the mutant ligand-binding domain of ERα LexA-mERα.
 
In our system, pRET2 is used to drive the expression of our receptor modules – Aryl hydrocarbon receptor - AhR (particularly Aryl hydrocarbon receptor nuclear translocator - ARNT and Nuclear Receptor Coactivator- NCOA), LexA domain fused with ligand-binding domain of Estrogen Receptor alpha LexA-ERα, with Estrogen-related Receptor gamma ligand-binding domain LexA-ERRγ and the mutant ligand-binding domain of ERα LexA-mERα.
  
 
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K5477000 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5477000 SequenceAndFeatures</partinfo>
ACGATGGCTTCTTATCTCACTTCAATAGTACTTTCCACCGGTTATACTTCCGGCTTTTCCCTATTAATACAAGCTACAATTTCAATGGGTGGCAAATAATGTGTAGAATAGAAAATAAGCCGACAGGGTAATAAAGAAAATTTTTAGAAAAAAAAGGTTAGATGGCTTATTTAAGTTACAGGCTAGCGAAAAAAGGAACTTCAGGGCAAGTAAAGTGTTTGATTGGGCACTAGCATGGCTTATAAAGGCGAGCAATTGTCGAAACTAATTAATGTTGTACGGACTATTGCTGTCTTCTCGTGGTAAATGCGTGTTCCAGGTCGAATACTACTTGCACACAGGCGAGCGGGGCCCCATAAAAGTGTTGCCGATTTGTTAAGTTGTCTTTTCGGTTTTTCTACTCTGTTATTCCTTACTTCCCTTTTTAAGAACTCTTTTTATCCTTCATTTAGGATCTTGCACGTTTCCGCCTCATCACTTGAATTAAAACATGTCTCTGTCAGTAAACCTTGGCGTTTCTATTGTTCTTCATAGTTCAACTTTTATTATTACCCGCCCTGCGCGTTTACATTTTTCCAGCAACAGCCAGCGAAAAATTAGAAAATCTGGTTGTTGACACCTCAAGAACAAGGGCAATTAGCCTCAGCGTCGAATATAGATCATATTAGAATACCTATAGCTCCATCAAAAGAAATACACA
 
 
 
<!-- Uncomment this to enable Functional Parameter display
 
===Functional Parameters===
 
<partinfo>BBa_K5477000 parameters</partinfo>
 
<!-- -->
 

Revision as of 18:12, 25 September 2024

pRET2 - medium strong constitutive promoter in Saccharomyces cerevisiae

RET2 is the delta subunit of the coatomer complex (COPI), which coats transport vesicles derived from the Golgi apparatus. It plays a key role in retrograde transport between the Golgi and endoplasmic reticulum (ER), ensuring proper protein and membrane trafficking within the cell (1).

Usage and Biology

From a paper of Lee et al. 2015, Figure 3A shows the relative strengths of 19 constitutive promoters by measuring fluorescence from two reporters, mRuby2 and Venus. From the data, pRET2 appears to be positioned in the medium-to-lower range of constitutive promoter strengths.

Figure 3A from Lee et al. 2015: The plot highlights three key promoters: pTDH3 (strong), pRPL18B (medium), and pREV1 (weak) (2). The horizontal and vertical bars represent the range of fluorescence from four biological replicates, with the intersection indicating the median. The inset also includes results from testing a third reporter, mTurquoise2, demonstrating consistent promoter strength across different reporter proteins.

In our system, pRET2 is used to drive the expression of our receptor modules – Aryl hydrocarbon receptor - AhR (particularly Aryl hydrocarbon receptor nuclear translocator - ARNT and Nuclear Receptor Coactivator- NCOA), LexA domain fused with ligand-binding domain of Estrogen Receptor alpha LexA-ERα, with Estrogen-related Receptor gamma ligand-binding domain LexA-ERRγ and the mutant ligand-binding domain of ERα LexA-mERα.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 182
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 37
  • 1000
    COMPATIBLE WITH RFC[1000]