Difference between revisions of "Part:BBa K191005:Design"
(→Design Notes) |
(→Source) |
||
Line 26: | Line 26: | ||
<partinfo>BBa_I6007</partinfo> for TetR. | <partinfo>BBa_I6007</partinfo> for TetR. | ||
− | < | + | <partinfo>BBa_K191007</partinfo> |
===References=== | ===References=== |
Latest revision as of 17:11, 21 October 2009
TRP promoter - RBS - TetR - Term - TetR promoter - RBS - RFP - Term
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 43
Illegal SpeI site found at 51 - 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 43
Illegal SpeI site found at 51 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal SpeI site found at 43
Illegal SpeI site found at 51 - 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 43
Illegal SpeI site found at 51
Illegal AgeI site found at 1576
Illegal AgeI site found at 1688 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
- This biobrick was created using our new method, which we named [http://2009.igem.org/wiki/index.php?title=Team:EPF-Lausanne/Protocols/1.5_steps_PCR 1.5-step PCR].
- Long primers are added first to amplify the DNA from the plasmid (this sequence is a part of BBa_I6007). Then short primers with iGEM prefix and suffix are added to amplify the entire sequence.
1st Forward primer: 5'-gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcaagttcacgtaaaaagggtatcgacaaagaggagaaatactagatgtcc-3'
2nd Forward primer: 5'-gtttcttcgaattcgcggccgcttctagagtggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagta-3'
1st Reverse primer: 5'-cagctcctcgcccttgctcaccatctagtatttctcctctttctctagtagtgc-3'
2nd Reverse primer: 5'-ctagctagcctctagtagtgctcagtatctctatcac-3'
- Trp promoter till TetR promoter was constructed with 1.5 step PCR then cut with E and S to be ligated into iGEM plasmid with RFP ( which was cut with E and X).
Source
BBa_I13507 for RFP.
BBa_I6007 for TetR.