Difference between revisions of "Part:BBa K5375010"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K5375010 short</partinfo>
 
<partinfo>BBa_K5375010 short</partinfo>
  
−
siPFN3-2
 
  
−
<!-- Add more about the biology of this part here
+
<!-- Add more about the biology of this part here -->
−
===Usage and Biology===
+
 
  
−
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K5375010 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5375010 SequenceAndFeatures</partinfo>
−
 
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K5375010 parameters</partinfo>
 
<partinfo>BBa_K5375010 parameters</partinfo>
−
<!-- -->
+
-->
 +
 
 +
__TOC__
 +
 
 +
<span id="origin"></span>
 +
= Origin =
 +
 
 +
Synthesized by company.
 +
 
 +
<span id="properties"></span>
 +
= Properties =
 +
 
 +
Inhibition of Profilin-3 (PFN3) expression.
 +
 
 +
<span id="usage-and-biology"></span>
 +
= Usage and Biology =
 +
 
 +
siPFN3-2 inhibits the target gene PFN3 as a small interfering RNA (siRNA). PFN3 is an actin-binding protein that is crucial for cytoskeletal dynamics in plants. Its conserved structure across plant taxa makes it a potent cross-reactive allergen (Rodríguez Del Río et al., 2018). Up to 20% of pollen allergies are triggered by profilins, with PFN3 being the greatest cause (Landa-Pineda et al., 2013). siRNA is a key component of the RNAi process, a powerful gene silencing mechanism. Once introduced into target cells, it is recognized and loaded into the RNA-Induced Silencing Complex (RISC). The siRNA’s antisense strand binds to the complementary target mRNA molecule, triggering the RISC complex to cleave the target mRNA and prevent it from being translated into a functional protein (Agrawal et al., 2003). The silencing effect typically lasts around 12 days.
 +
 
 +
siPFN3-2 is useful in plant cells, where it successfully inhibits the expression of the pan-allergen PFN3, alleviating and reducing allergic symptoms related to *Populus tomentosa* pollen allergy.
 +
 
 +
<span id="cultivation-purification"></span>
 +
= Cultivation and Purification =
 +
 
 +
siPFN3-2 is synthesized through oligonucleotides with a nucleic acid synthesizer. The following sequences represent the sense and antisense strands of the siRNA:
 +
 
 +
- Oligo Sequence for siPFN3-2-SS: CAAAGUACAUGGUGAUCCAGG
 +
- Oligo Sequence for siPFN3-2-AS: UGGAUCACCAUGUACUUUGUG
 +
 
 +
These oligonucleotides are then annealed to form a double-stranded siRNA molecule. The siRNA is purified using high-performance liquid chromatography (HPLC) (Sohail et al., 2003). To enhance delivery into plant cells, carbon dots (CDs) were incorporated with Polyethyleneimine (PEI) through the microwave method, allowing the negatively charged siRNA to bind to the CDs.
 +
 
 +
<span id="measurement-characterization"></span>
 +
= Measurement and Characterization =
 +
 
 +
<html>
 +
<div style="text-align:center;">
 +
    <img src="https://static.igem.wiki/teams/5375/bba-k5375010/1.png" width="50%" style="display:block; margin:auto;" alt="RT-qPCR results for protoplasts" >
 +
    <div style="text-align:center;">
 +
        <caption>Figure 1. RT-qPCR results for protoplasts.</caption>
 +
    </div>
 +
</div>
 +
</html>
 +
 
 +
The chart demonstrates the performance of siPFN3-2 in inhibiting PFN3 expression. Results show that siPFN3-2 was unable to repress PFN3 expression in protoplasts. However, further trials are required to verify its efficacy in other contexts.
 +
 
 +
<html>
 +
<div style="text-align:center;">
 +
    <img src="https://static.igem.wiki/teams/5375/bba-k5375010/2.png" width="50%" style="display:block; margin:auto;" alt="RT-qPCR results for tobacco leaf injection" >
 +
    <div style="text-align:center;">
 +
        <caption>Figure 2. RT-qPCR results for tobacco leaf injection.</caption>
 +
    </div>
 +
</div>
 +
</html>
 +
 
 +
RT-qPCR results for siRNA injection in tobacco leaves. siPFN3-2, when combined with CDs, successfully repressed PFN3 expression, halving the expression levels.
 +
 
 +
<html>
 +
<div style="text-align:center;">
 +
    <img src="https://static.igem.wiki/teams/5375/bba-k5375010/3.png" width="50%" style="display:block; margin:auto;" alt="RT-qPCR results for osmanthus tree trunk injection" >
 +
    <div style="text-align:center;">
 +
        <caption>Figure 3. RT-qPCR results for osmanthus tree trunk injection.</caption>
 +
    </div>
 +
</div>
 +
</html>
 +
 
 +
RT-qPCR results for siRNA delivery through trunk injection in osmanthus trees. siPFN3-2, combined with CDs, did not demonstrate success in inhibiting PFN3 expression. However, the results may be inconclusive due to insufficient time for the tree to fully process the siRNA. Further trials are necessary to determine the effectiveness of siPFN3-2 in different contexts.
 +
 
 +
Further trials and improvements are needed to ensure optimal efficacy of siPFN3-2 in target gene repression.
 +
 
 +
<span id="reference"></span>
 +
= Reference =
 +
 
 +
Landa-Pineda C. M., Guidos-Fogelbach G., Marchat-Marchau L., López-Hidalgo M., Arroyo-Becerra A., & Sandino Reyes-López C. A. (2013). Profilinas: alergenos con relevancia clínica [Profilins: allergens with clinical relevance]. *Revista Alergia Mexico*, 60(3), 129–143.
 +
 
 +
Rodríguez Del Río P., Díaz-Perales A., Sánchez-García S., Escudero C., Ibáñez M. D., Méndez-Brea P., & Barber D. (2018). Profilin, a Change in the Paradigm. *Journal of Investigational Allergology & Clinical Immunology*, 28(1), 1–12. [https://doi.org/10.18176/jiaci.0193](https://doi.org/10.18176/jiaci.0193)
 +
 
 +
Sohail M., Doran G., Riedemann J., Macaulay V., & Southern E. M. (2003). A simple and cost-effective method for producing small interfering RNAs with high efficacy. *Nucleic Acids Research*, 31(7), e38.

Revision as of 11:24, 25 September 2024

siPFN3-2



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Origin

Synthesized by company.

Properties

Inhibition of Profilin-3 (PFN3) expression.

Usage and Biology

siPFN3-2 inhibits the target gene PFN3 as a small interfering RNA (siRNA). PFN3 is an actin-binding protein that is crucial for cytoskeletal dynamics in plants. Its conserved structure across plant taxa makes it a potent cross-reactive allergen (Rodríguez Del Río et al., 2018). Up to 20% of pollen allergies are triggered by profilins, with PFN3 being the greatest cause (Landa-Pineda et al., 2013). siRNA is a key component of the RNAi process, a powerful gene silencing mechanism. Once introduced into target cells, it is recognized and loaded into the RNA-Induced Silencing Complex (RISC). The siRNA’s antisense strand binds to the complementary target mRNA molecule, triggering the RISC complex to cleave the target mRNA and prevent it from being translated into a functional protein (Agrawal et al., 2003). The silencing effect typically lasts around 12 days.

siPFN3-2 is useful in plant cells, where it successfully inhibits the expression of the pan-allergen PFN3, alleviating and reducing allergic symptoms related to *Populus tomentosa* pollen allergy.

Cultivation and Purification

siPFN3-2 is synthesized through oligonucleotides with a nucleic acid synthesizer. The following sequences represent the sense and antisense strands of the siRNA:

- Oligo Sequence for siPFN3-2-SS: CAAAGUACAUGGUGAUCCAGG - Oligo Sequence for siPFN3-2-AS: UGGAUCACCAUGUACUUUGUG

These oligonucleotides are then annealed to form a double-stranded siRNA molecule. The siRNA is purified using high-performance liquid chromatography (HPLC) (Sohail et al., 2003). To enhance delivery into plant cells, carbon dots (CDs) were incorporated with Polyethyleneimine (PEI) through the microwave method, allowing the negatively charged siRNA to bind to the CDs.

Measurement and Characterization

RT-qPCR results for protoplasts
Figure 1. RT-qPCR results for protoplasts.

The chart demonstrates the performance of siPFN3-2 in inhibiting PFN3 expression. Results show that siPFN3-2 was unable to repress PFN3 expression in protoplasts. However, further trials are required to verify its efficacy in other contexts.

RT-qPCR results for tobacco leaf injection
Figure 2. RT-qPCR results for tobacco leaf injection.

RT-qPCR results for siRNA injection in tobacco leaves. siPFN3-2, when combined with CDs, successfully repressed PFN3 expression, halving the expression levels.

RT-qPCR results for osmanthus tree trunk injection
Figure 3. RT-qPCR results for osmanthus tree trunk injection.

RT-qPCR results for siRNA delivery through trunk injection in osmanthus trees. siPFN3-2, combined with CDs, did not demonstrate success in inhibiting PFN3 expression. However, the results may be inconclusive due to insufficient time for the tree to fully process the siRNA. Further trials are necessary to determine the effectiveness of siPFN3-2 in different contexts.

Further trials and improvements are needed to ensure optimal efficacy of siPFN3-2 in target gene repression.

Reference

Landa-Pineda C. M., Guidos-Fogelbach G., Marchat-Marchau L., López-Hidalgo M., Arroyo-Becerra A., & Sandino Reyes-López C. A. (2013). Profilinas: alergenos con relevancia clínica [Profilins: allergens with clinical relevance]. *Revista Alergia Mexico*, 60(3), 129–143.

Rodríguez Del Río P., Díaz-Perales A., Sánchez-García S., Escudero C., Ibáñez M. D., Méndez-Brea P., & Barber D. (2018). Profilin, a Change in the Paradigm. *Journal of Investigational Allergology & Clinical Immunology*, 28(1), 1–12. [1](https://doi.org/10.18176/jiaci.0193)

Sohail M., Doran G., Riedemann J., Macaulay V., & Southern E. M. (2003). A simple and cost-effective method for producing small interfering RNAs with high efficacy. *Nucleic Acids Research*, 31(7), e38.