Difference between revisions of "Part:BBa K5267011"
| Line 27: | Line 27: | ||
The cloned mpPGK is very active in driving transcription of reporter genes following transfection into mammalian cells<sup>[2]</sup>. The promoter is particularly active in pluripotent embryonal carcinoma and embryonic stem cells. | The cloned mpPGK is very active in driving transcription of reporter genes following transfection into mammalian cells<sup>[2]</sup>. The promoter is particularly active in pluripotent embryonal carcinoma and embryonic stem cells. | ||
<br>An initial studie on the Pgk-1 promoter indicated that its activity was contained within a region from −425 bp to +80 bp relative to the first transcription start site[2]. This promoter is GC rich and contains no TATA box<sup>[3]</sup>. The data from John P. Thomson et al. indicate that a primary function of non-methylated CGIs is to genetically influence the local chromatin modification state to initiate transcriptionby interaction with Cfp1 and perhaps other CpG-binding proteins<sup>[4]</sup>. The core promoter from −121 bp to +80 bp contains a number of putative Spl binding sites and had modest promoter activity. The 304 bp upstream of the core promoter had enhancer-like activity such that this region increased expression from the core promoter in an orientation- and position-independent fashion. | <br>An initial studie on the Pgk-1 promoter indicated that its activity was contained within a region from −425 bp to +80 bp relative to the first transcription start site[2]. This promoter is GC rich and contains no TATA box<sup>[3]</sup>. The data from John P. Thomson et al. indicate that a primary function of non-methylated CGIs is to genetically influence the local chromatin modification state to initiate transcriptionby interaction with Cfp1 and perhaps other CpG-binding proteins<sup>[4]</sup>. The core promoter from −121 bp to +80 bp contains a number of putative Spl binding sites and had modest promoter activity. The 304 bp upstream of the core promoter had enhancer-like activity such that this region increased expression from the core promoter in an orientation- and position-independent fashion. | ||
| + | |||
| + | |||
| + | ===Sequence=== | ||
| + | Top: | ||
| + | <br>GGAGCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCC | ||
| + | <br>TCGCACACATTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCC | ||
| + | <br>CCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCAGTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGT | ||
| + | <br>AGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTC | ||
| + | <br>AGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGG | ||
| + | <br>GCCTTTCGACCTCCAGCCCTACT | ||
| + | |||
| + | ===Reference=== | ||
| + | [1] SUTHERLAND L C, ST-ARNAUD R, MCBURNEY M W. An upstream activator sequence regulates the murine Pgk-1 promoter and binds multiple nuclear proteins [J]. Gene expression, 1995, 4(4-5): 265-79. | ||
| + | <br>[2] MCBURNEY M W, SUTHERLAND L C, ADRA C N, et al. The mouse Pgk-1 gene promoter contains an upstream activator sequence [J]. Nucleic acids research, 1991, 19(20): 5755-61. | ||
| + | <br>[3] ADRA C N, BOER P H, MCBURNEY M W. Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter [J]. Gene, 1987, 60(1): 65-74. | ||
| + | <br>[4] THOMSON J P, SKENE P J, SELFRIDGE J, et al. CpG islands influence chromatin structure via the CpG-binding protein Cfp1 [J]. Nature, 2010, 464(7291): 1082-U162. | ||
Revision as of 09:00, 22 September 2024
mPGK Promoter
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 116
- 1000COMPATIBLE WITH RFC[1000]
Profile
Name: mPGK promoter
Base Pairs: 516bp
Origin: Mouse
Properties: promoter that responsible for transcription of MTNR1a
Usage and Biology
MPGK promoter(mpPGK) is the promoter of Pgk1 in mouse cell. Pgk-1 is the murine gene encoding phosphoglycerate kinase (PGK), a key enzyme in glycolysis. This enzyme must be present in all cells, so the Pgk-1 promoter is expected to be a ubiquitously active one[1].
The cloned mpPGK is very active in driving transcription of reporter genes following transfection into mammalian cells[2]. The promoter is particularly active in pluripotent embryonal carcinoma and embryonic stem cells.
An initial studie on the Pgk-1 promoter indicated that its activity was contained within a region from −425 bp to +80 bp relative to the first transcription start site[2]. This promoter is GC rich and contains no TATA box[3]. The data from John P. Thomson et al. indicate that a primary function of non-methylated CGIs is to genetically influence the local chromatin modification state to initiate transcriptionby interaction with Cfp1 and perhaps other CpG-binding proteins[4]. The core promoter from −121 bp to +80 bp contains a number of putative Spl binding sites and had modest promoter activity. The 304 bp upstream of the core promoter had enhancer-like activity such that this region increased expression from the core promoter in an orientation- and position-independent fashion.
Sequence
Top:
GGAGCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCC
TCGCACACATTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCC
CCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCAGTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGT
AGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTC
AGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGG
GCCTTTCGACCTCCAGCCCTACT
Reference
[1] SUTHERLAND L C, ST-ARNAUD R, MCBURNEY M W. An upstream activator sequence regulates the murine Pgk-1 promoter and binds multiple nuclear proteins [J]. Gene expression, 1995, 4(4-5): 265-79.
[2] MCBURNEY M W, SUTHERLAND L C, ADRA C N, et al. The mouse Pgk-1 gene promoter contains an upstream activator sequence [J]. Nucleic acids research, 1991, 19(20): 5755-61.
[3] ADRA C N, BOER P H, MCBURNEY M W. Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter [J]. Gene, 1987, 60(1): 65-74.
[4] THOMSON J P, SKENE P J, SELFRIDGE J, et al. CpG islands influence chromatin structure via the CpG-binding protein Cfp1 [J]. Nature, 2010, 464(7291): 1082-U162.