Difference between revisions of "Part:BBa K5143025"
Line 7: | Line 7: | ||
<h1>Description</h1> | <h1>Description</h1> | ||
<p> | <p> | ||
− | + | This part was designed to be used in Saccharomyces cerevisiae. Its main components are fwYellow(<ahref="https://parts.igem.org/Part:BBa_K5143023">BBa_K5143023</a>) and Cp19k-MaSp1 (<ahref="https://parts.igem.org/Part:BBa_K5143022">BBa_K5143022</a>) fused together (<a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>). By digesting this part with XhoI, the linearize fragment could be transformed in the yeast in order to recombinate with the Ura locus in S. cerevisiae BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD gene and the alphafactor-MaSp1-CBD gene. In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose. | |
− | + | ||
</p> | </p> | ||
− | <img src="https://static.igem.wiki/teams/5143/ | + | <img src="https://static.igem.wiki/teams/5143/bba-k5143025-functionalised-cellulose.png" width="400" alt="Cp19k-MaSp1"> |
<h1>Construction</h1> | <h1>Construction</h1> | ||
<p> | <p> |
Revision as of 14:32, 21 September 2024
Plasmid D
</head> <body>
Description
This part was designed to be used in Saccharomyces cerevisiae. Its main components are fwYellow(<ahref="https://parts.igem.org/Part:BBa_K5143023">BBa_K5143023</a>) and Cp19k-MaSp1 (<ahref="https://parts.igem.org/Part:BBa_K5143022">BBa_K5143022</a>) fused together (<a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>). By digesting this part with XhoI, the linearize fragment could be transformed in the yeast in order to recombinate with the Ura locus in S. cerevisiae BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD gene and the alphafactor-MaSp1-CBD gene. In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose.
<img src="" width="400" alt="Cp19k-MaSp1">
Construction
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae .
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: <a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>
It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a>
References
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: <a href="https://doi.org/10.1016/j.ijbiomac.2023.127125" target="_blank">10.1016/j.ijbiomac.2023.127125</a>. Epub 2023 Sep 28. PMID: 37776922.
</body> </html>
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 577
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 1000COMPATIBLE WITH RFC[1000]