Difference between revisions of "Part:BBa K5317012"

Line 5: Line 5:
 
===Usage and Biology===
 
===Usage and Biology===
  
The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez et al. 2019, Wimmer et al. 2005). Activation of MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters, and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez et al. 2019). Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H2O2, low extracellular pH (Saydam et al. 2001).  
+
The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez ''et al.'', 2019; Wimmer ''et al.'', 2005). Activation of MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters, and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez ''et al.'', 2019). Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H2O2, low extracellular pH (Saydam ''et al.'', 2001).  
  
 
The composite part fusing the MTF-1 with the reporter protein mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) enables the visualization of the transcription factor localization in the cell in dependence of the free metal ion concentration. Its integration into a plasmid was needed for running the co-transfecting experiments together with the MRE-containing promoters upstream of EGFP to built the cell-based metal detection sensor.  
 
The composite part fusing the MTF-1 with the reporter protein mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) enables the visualization of the transcription factor localization in the cell in dependence of the free metal ion concentration. Its integration into a plasmid was needed for running the co-transfecting experiments together with the MRE-containing promoters upstream of EGFP to built the cell-based metal detection sensor.  

Revision as of 17:57, 24 September 2024


CMV-MTF1-mRuby2

Usage and Biology

The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez et al., 2019; Wimmer et al., 2005). Activation of MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters, and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez et al., 2019). Additional stimuli of MTF-1 nucleus import are stress signals such as heat shock, H2O2, low extracellular pH (Saydam et al., 2001).

The composite part fusing the MTF-1 with the reporter protein mRuby2 (K5317001) enables the visualization of the transcription factor localization in the cell in dependence of the free metal ion concentration. Its integration into a plasmid was needed for running the co-transfecting experiments together with the MRE-containing promoters upstream of EGFP to built the cell-based metal detection sensor.


Cloning

Theoretical Part Design

In order to generate the composite part, the basic part MTF-1 (K5317007) was integrated together with the reporter gene mRuby2 (K5317001) into the EGFP-C2 (K3338020) backbone after NheI- and BamHI-digestion. The Stop codon at the C-terminus of MTF-1 was deleted to ensure undisturbed translation of the C-terminal placed mRuby2.

Sequence and Features

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1785
    Illegal PstI site found at 1030
    Illegal PstI site found at 1362
    Illegal PstI site found at 1819
    Illegal PstI site found at 1886
    Illegal PstI site found at 1924
    Illegal PstI site found at 2341
    Illegal PstI site found at 2671
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1785
    Illegal PstI site found at 1030
    Illegal PstI site found at 1362
    Illegal PstI site found at 1819
    Illegal PstI site found at 1886
    Illegal PstI site found at 1924
    Illegal PstI site found at 2341
    Illegal PstI site found at 2671
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1785
    Illegal BamHI site found at 1220
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1785
    Illegal PstI site found at 1030
    Illegal PstI site found at 1362
    Illegal PstI site found at 1819
    Illegal PstI site found at 1886
    Illegal PstI site found at 1924
    Illegal PstI site found at 2341
    Illegal PstI site found at 2671
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1785
    Illegal PstI site found at 1030
    Illegal PstI site found at 1362
    Illegal PstI site found at 1819
    Illegal PstI site found at 1886
    Illegal PstI site found at 1924
    Illegal PstI site found at 2341
    Illegal PstI site found at 2671
    Illegal NgoMIV site found at 2599
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2710

Cloning

The CMV promoter was provided by the EGFP-C2 backbone and remained throughout the NheI- and BamHI-digestion, while the EGFP was cut out. The correct assembly order, placing MTF-1 downstream of the CMV promoter and fusing mRuby2 to its C-terminus, was achieved by amplyfying the inserts with the primers listed in table 1, creating about 20 bp overhangs.

HTML Table Caption Table1: Primers used to create matching overhangs on MTF-1 and mRuby2 amplicon to digested pEGFP-C2 backbone

Primer name Sequence
MTF1_fw CAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGGGAACACAGTCCAGAC
MTF1_rev gcccttagacaccatGGGTGGCAGCTGCAGG
mRuby2_fw CTGCAGCTGCCACCCatggtgtctaagggcgaagagc
mRuby2_rev ATCCCGGGCCCGCGGTACCGTCGACTGCAGcttgtacagctcgtccatccc

Characterization

The CMV promoter ensures a strong and constitutive expression of the MTF-1 protein in HEK293T cells and the C-terminally fused mRuby2 fluorescent protein allows for the tracking of MTF-1 during varying conditions.

As described in the Usage and Biology section, MTF-1 is capable of binding metal-ions direct or indirect, which leads to the translocation of MTF-1 from the cytoplasms into the nucleus. Therefore, we conducted experiments first analyzing the localization of MTF-1 by single-transfecting HEK293T cells with the CMV-MTF1-mRuby2-C2 plasmid with and without the presence of CuSo4 via microscopy.


References

Saydam, N., Georgiev, O., Nakano, M. Y., Greber, U. F., & Schaffner, W. (2001). Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. The Journal of biological chemistry, 276(27), 25487–25495. https://doi.org/10.1074/jbc.M009154200

Tavera-Montañez, C., Hainer, S. J., Cangussu, D., Gordon, S. J. V., Xiao, Y., Reyes-Gutierrez, P., Imbalzano, A. N., Navea, J. G., Fazzio, T. G., & Padilla-Benavides, T. (2019). The classic metal-sensing transcription factor MTF1 promotes myogenesis in response to copper. FASEB journal: official publication of the Federation of American Societies for Experimental Biology, 33(12), 14556–14574. https://doi.org/10.1096/fj.201901606R

Wimmer, U., Wang, Y., Georgiev, O., & Schaffner, W. (2005). Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic acids research, 33(18), 5715–5727. https://doi.org/10.1093/nar/gki881