Difference between revisions of "Part:BBa K5317009"

Line 7: Line 7:
 
The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.
 
The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.
  
In an effort to increase the efficiency of the activated MTF1 responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317003 K5317003]</span>).  
+
In an effort to increase the efficiency of the activated MTF-1-responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317003 K5317003]</span>).  
  
 
=Cloning=
 
=Cloning=

Revision as of 17:51, 24 September 2024


4xMREa-EGFP

Usage and Biology

The MRE-sites containing promoter enables the metal-dependent expression of the downstream positioned reporter EGFP via the metal ion-dependent transcription factor MTF-1 for cell-based metal detection.

In an effort to increase the efficiency of the activated MTF-1-responsive promoter, we constructed a synthetic promoter with multiple MREa sites. Searle and colleagues described 1985 that at least two MREa sites are necessary for the zinc-induced expression of the downstream gene, here herpes simplex virus thymidine kinase. They also showed that the positioning of the MREs in the promoter sequence had little effect on the promoter efficiency but was increased with more MREa sites inserted. Therefore, we put a promoter together with four MREa sites positioned at the sites of the MREwt promoter (K5317003).

Cloning

Theoretical Part Design

Placing the 4xMREa-containing promoter upstream of the reporter gene EGFP allows the visualization of primarily metal-dependent activation of MTF-1.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Cloning

Therefore, the promoter was synthesized and inserted by NEB HiFi Assembly into the pEGFP-C2 backbone plasmid (K3338020) after its restriction enzyme digestion with AseI and NheI, generating the MREwt-EGFP cassette.

HTML Table Caption Table1: Primers used to create matching overhangs on promoter amplicon to digested pEGFP-C2 backbone

Primer name Sequence
4xMREa_fw CCGCCATGCATTAGTTATGCACACTGGCGCT
4xMREa_rev TGGCGACCGGTAGCGGACGCTTAGAGGACAGC

The vector map of the assembled construct is shown in figure 1.

Reference

Searle, P. F., Stuart, G. W., & Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Molecular and cellular biology, 5(6), 1480–1489. https://doi.org/10.1128/mcb.5.6.1480-1489.1985