Difference between revisions of "Part:BBa K5267008"

 
Line 3: Line 3:
 
<partinfo>BBa_K5267008 short</partinfo>
 
<partinfo>BBa_K5267008 short</partinfo>
  
−
cAMP Response Element (CRE) is a DNA sequence found in the promoter regions of many genes. It functions as a binding site for cAMP Response Element Binding Protein (CREB).CRE serves as a regulatory element that CREB binds to in the presence of elevated cAMP (cyclic adenosine monophosphate) levels, which are triggered by various signaling pathways. This binding regulates gene expression by promoting or inhibiting transcription.
+
Transpose and respond to calcium ion signals
−
 
+
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
Line 17: Line 16:
 
<partinfo>BBa_K5267008 parameters</partinfo>
 
<partinfo>BBa_K5267008 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Profile===
 +
Name: P_min5*NFAT_IL4
 +
<br>Base Pairs: 191bp
 +
<br>Origin: Homo sapiens
 +
<br>Properties: Transpose and respond to calcium ion signals
 +
 +
 +
===Usage and Biology===
 +
P_min is short for minimal promoter, which is the minimal version of the promoter sequence that contains elements necessary for transcription factor binding, but usually does not contain enhancers or other regulatory elements<sup>[1]</sup>.
 +
<br>NFAT_IL4 is a component of interleukin-4 (IL-4) transcription promoter which is responsive to nuclear factor of activated T cells (NFAT). And NFAT can response to calcium ions. In our project, we choose calcium pathway as one of the downstream pathways of melatonin receptor MT1. So NFAT_IL4 can characterize the binding of melatonin and MT1.
 +
 +
 +
===Special design===
 +
5*NFAT_IL4 is the 5-fold version of NFAT_IL4. Considering that the expression effect of a single responder is weak, we insert multiple tandem repeats of the same responder element to the upstream of P_min to enhance the activation of the signaling pathway. This part is the combination of NFAT_IL4 clone four times and P_min.
 +
 +
 +
===Function test===
 +
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 1)'''
 +
In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/3.jpg" class="figure-img img-fluid rounded"  height="300px">
 +
 +
</html>
 +
 +
 +
===Sequence===
 +
Top:
 +
<br>GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
 +
<br>GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
 +
<br>CAGTACT
 +
 +
 +
===Reference===
 +
[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
 +
<br>[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
 +
<br>[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.

Revision as of 16:12, 22 September 2024


Pmin_5*NFAT promoter

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: P_min5*NFAT_IL4
Base Pairs: 191bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals


Usage and Biology

P_min is short for minimal promoter, which is the minimal version of the promoter sequence that contains elements necessary for transcription factor binding, but usually does not contain enhancers or other regulatory elements[1].
NFAT_IL4 is a component of interleukin-4 (IL-4) transcription promoter which is responsive to nuclear factor of activated T cells (NFAT). And NFAT can response to calcium ions. In our project, we choose calcium pathway as one of the downstream pathways of melatonin receptor MT1. So NFAT_IL4 can characterize the binding of melatonin and MT1.


Special design

5*NFAT_IL4 is the 5-fold version of NFAT_IL4. Considering that the expression effect of a single responder is weak, we insert multiple tandem repeats of the same responder element to the upstream of P_min to enhance the activation of the signaling pathway. This part is the combination of NFAT_IL4 clone four times and P_min.


Function test

In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. (Figure 1) In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.


Sequence

Top:
GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
CAGTACT


Reference

[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.