Difference between revisions of "Part:BBa K5143003"
Perrine-fdn (Talk | contribs) |
|||
Line 13: | Line 13: | ||
<h1>Construction</h1> | <h1>Construction</h1> | ||
<p> | <p> | ||
− | The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. <br> | + | The codons were optimised for synthesis and expression in <I> Saccharomyces cerevisiae </I>. <br> |
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT <br> | MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT <br> | ||
This composite part is part of the following larger composite part: put name composite part <br> | This composite part is part of the following larger composite part: put name composite part <br> |
Revision as of 16:05, 14 August 2024
Description
Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/m²
Construction
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae .
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: put name composite part
It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005
References
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 577
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 746
Illegal PstI site found at 1049
Illegal PstI site found at 1142
Illegal PstI site found at 1148 - 1000COMPATIBLE WITH RFC[1000]