Difference between revisions of "Part:BBa K5133004"

Revision as of 13:04, 29 July 2024

sfGFP generator for CFPS (cell-free protein synthesis)

Group: GEC-China (iGEM 2024, team number: #5133)

Introduction

This composite part is derived from plasmid pJL1 (Addgene: #69496)^[1], consisting of four basic parts: T7 promoter (BBa_K5133000), ribosome binding site (RBS, BBa_K5133001), coding sequence of superfolder green fluorescent protein (sfGFP, BBa_K5133002), and T7 terminator (BBa_K5133003)(Figures 1, 2). The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)^[2], however, an iGEM-standarized CFPS construction has not yet been commonly reported and characterized yet. Hence, this part is established to demonstrate the feasibility of CFPS in our project.

Results

For the characterization process of this part, follow five steps showing in Figure 3: (1) molecular cloning; (2) colony PCR; (3) sequencing; (4) plasmid extraction; (5) CFPS reaction.

Step 1: molecular cloning

To construct this part, we first need to acquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inserted fragments by using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (Figure 4) as pSB1C3 (2070 bp) and inserted fragment (988 bp) used in this construction.

When we got the purified DNA products, then we assembled these fragments by using Gibson Assembly strategy^[3]. Next, we transformed the reaction to competent E. coli Mach1-T1 cells and spread the transformants onto LB-agar plates containing 34µg/mL chloramphenicol. As shown in Figure 5, the E. coli transformants could normally grew on LB-agar plates and be used for the following experiments.

Usages

This part is used for the construction of composite part BBa_K5133004 (sfGFP generator) to demonstrate the feasibility of CFPS in our project. Please see the detailed experimental results in BBa_K5133004.

DNA sequence (from 5' to 3')

atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataa

Red font: Strep-Tag II, from pJL1^[1]

References

[1] https://www.addgene.org/69496/

[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327

[3] Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6, 343-345 (2009). doi: 10.1038/nmeth.1318

Sequence and Features