Difference between revisions of "Part:BBa K5133004"
Line 8: Line 8:
 
==<b>Brief introduction</b>==
 
==<b>Brief introduction</b>==
  
−
This basic part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, including a DNA sequence for coding sfGFP (superfolder green fluorescent protein). The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>. Hence, this part is used for the construction of composite part <bbpart>BBa_K5133004</bbpart> to demonstrate the feasibility of CFPS in our project.
+
This composite part is derived from plasmid pJL1 (Addgene: #69496)<sup>[1]</sup>, consisting of four basic parts: T7 promoter (<bbpart>BBa_K5133000</bbpart>), ribosome binding site (RBS, <bbpart>BBa_K5133001</bbpart>), coding sequence of superfolder green fluorescent protein (sfGFP, <bbpart>BBa_K5133002</bbpart>), and T7 terminator (<bbpart>BBa_K5133003</bbpart>)<b>Figure 1, 2</b>.The plasmid pJL1 is commonly used for the <i>in vitro</i> sfGFP expression of cell-free protein synthesis (CFPS)<sup>[2]</sup>, however, an iGEM-based CFPS plasmid has not yet been constructed and characterized yet. Hence, this part is established to demonstrate the feasibility of CFPS in our project.
  
  
−
==<b>Design and characterization</b>==
+
<center>
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Resizable Image</title>
 +
    <style>
 +
        .resizable-img1 {
 +
            max-width: 60%;
 +
            height: auto;
 +
        }
 +
    </style>
 +
</head>
 +
<body>
 +
    <img src="https://static.igem.wiki/teams/5133/bba-k5133004-33.jpg"  class="resizable-img1">
 +
</body>
 +
</html>
 +
</center>
 +
 
 +
 
 +
<center><b>Figure 1. Schematic design of this part, generated by SnapGene.</b></center>
 +
 
  
−
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. To validate the correctness of DNA sequence, result of Sanger sequencing for <bbpart>BBa_K5133004</bbpart> show the successful assembly among T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), sfGFP (this part), and T7 terminator (<bbpart>BBa_K5133003</bbpart>) in <b>Figure 2</b>.
 
  
  
Line 30: Line 50:
 
</head>
 
</head>
 
<body>
 
<body>
−
     <img src="https://static.igem.wiki/teams/5133/bba-k5133002-1.jpg"  class="resizable-img1">
+
     <img src="https://static.igem.wiki/teams/5133/bba-k5133004-333.jpg"  class="resizable-img1">
 
</body>
 
</body>
 
</html>
 
</html>
Line 36: Line 56:
  
  
−
<center><b>Figure 1. Schematic design of this part, generated by SnapGene.</b></center>
+
<center><b>Figure 2. Detailed constitute of this composite part, including four basic parts: T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS <bbpart>BBa_K5133001</bbpart>), sfGFP <bbpart>BBa_K5133002</bbpart>), and T7 terminator (<bbpart>BBa_K5133003</bbpart>).</b></center>
 +
 
 +
 
 +
==<b>Design and characterization</b>==
 +
 
 +
The plasmid design of this biological part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. To validate the correctness of DNA sequence, result of Sanger sequencing for <bbpart>BBa_K5133004</bbpart> show the successful assembly among T7 promoter (<bbpart>BBa_K5133000</bbpart>), RBS (<bbpart>BBa_K5133001</bbpart>), sfGFP (this part), and T7 terminator (<bbpart>BBa_K5133003</bbpart>) in <b>Figure 2</b>.
  
  

Revision as of 12:15, 29 July 2024


sfGFP generator for CFPS (cell-free protein synthesis)

Group: GEC-China (iGEM 2024, team number: #5133)


Brief introduction

This composite part is derived from plasmid pJL1 (Addgene: #69496)[1], consisting of four basic parts: T7 promoter (BBa_K5133000), ribosome binding site (RBS, BBa_K5133001), coding sequence of superfolder green fluorescent protein (sfGFP, BBa_K5133002), and T7 terminator (BBa_K5133003)Figure 1, 2.The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[2], however, an iGEM-based CFPS plasmid has not yet been constructed and characterized yet. Hence, this part is established to demonstrate the feasibility of CFPS in our project.


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.



Resizable Image


Figure 2. Detailed constitute of this composite part, including four basic parts: T7 promoter (BBa_K5133000), RBS BBa_K5133001), sfGFP BBa_K5133002), and T7 terminator (BBa_K5133003).


Design and characterization

The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. To validate the correctness of DNA sequence, result of Sanger sequencing for BBa_K5133004 show the successful assembly among T7 promoter (BBa_K5133000), RBS (BBa_K5133001), sfGFP (this part), and T7 terminator (BBa_K5133003) in Figure 2.



Resizable Image


Figure 2. Validation of DNA sequence by Sanger sequencing, generated by SnapGene.




Usages

This part is used for the construction of composite part BBa_K5133004 (sfGFP generator) to demonstrate the feasibility of CFPS in our project. Please see the detailed experimental results in BBa_K5133004.


DNA sequence (from 5' to 3')

atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataa

Red font: Strep-Tag II, from pJL1[1]


References

[1] https://www.addgene.org/69496/


[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327



Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 51
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 51
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 51
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 32