Difference between revisions of "Part:BBa K4765129"

Line 56: Line 56:
 
2. Sample Preparation: Transfer 25 μL of the bacterial culture from each well into another 96-well plate and dilute them with 75 μL of PBS.<br>
 
2. Sample Preparation: Transfer 25 μL of the bacterial culture from each well into another 96-well plate and dilute them with 75 μL of PBS.<br>
 
3. Fluorescence Measurement: Use the microplate reader to measure GFP/RFP fluorescence. Set the excitation wavelength at 485/540 nm and the emmison wavelength at 528/620 nm.
 
3. Fluorescence Measurement: Use the microplate reader to measure GFP/RFP fluorescence. Set the excitation wavelength at 485/540 nm and the emmison wavelength at 528/620 nm.
 +
{|
 +
| <html><img style="width:500px" src="https://static.igem.wiki/teams/4765/wiki/results-wyj/96-23ll-plate.jpg" alt="contributed by Fudan iGEM 2023"></html>
 +
|-
 +
| '''Figure 4. The 96 well plate of bacterial cultures.'''
 +
|}
  
 
====Experimental Results====
 
====Experimental Results====
 
Our experimental findings unveiled a clear connection: as the change in free energy (ΔG) within the reaction decreases, mRNA stability increases, resulting in a higher GFP/RFP ratio. In summary, designing stem-loops with lower ΔG values enhances their ability to shield mRNA from degradation.
 
Our experimental findings unveiled a clear connection: as the change in free energy (ΔG) within the reaction decreases, mRNA stability increases, resulting in a higher GFP/RFP ratio. In summary, designing stem-loops with lower ΔG values enhances their ability to shield mRNA from degradation.
 
{|
 
{|
| <html><img style="width:640px" src="https://static.igem.wiki/teams/4765/wiki/results-wyj/ribozyme-czy.jpg" alt="contributed by Fudan iGEM 2023"></html>
+
| <html><img style="width:500px" src="https://static.igem.wiki/teams/4765/wiki/results-wyj/ribozyme-czy.jpg" alt="contributed by Fudan iGEM 2023"></html>
 
|-
 
|-
| '''Figure 4. The relationship between the free enegy of stem-loop and GFP/OD and RFP/OD.'''
+
| '''Figure 5. The relationship between the free enegy of stem-loop and GFP/OD and RFP/OD.'''
 
|}
 
|}
  
 
{|
 
{|
| <html><img style="width:400px" src="https://static.igem.wiki/teams/4765/wiki/czy/result.svg" alt="contributed by Fudan iGEM 2023"></html>
+
| <html><img style="width:500px" src="https://static.igem.wiki/teams/4765/wiki/czy/result.svg" alt="contributed by Fudan iGEM 2023"></html>
 
|-
 
|-
| '''Figure 5. The relationship between the free enegy of stem-loop and mRNA degradation rate.'''
+
| '''Figure 6. The relationship between the free enegy of stem-loop and mRNA degradation rate.'''
 
|}
 
|}
  

Revision as of 12:52, 12 October 2023


stem-loop test contributed by Fudan iGEM 2023


Introduction

In synthetic biology, it's common to integrate multiple heterologous genes into genetic circuits. Conventional approaches often utilize a polycistron system, where several genes are regulated under a single promoter. However, this can lead to reduced expression of downstream genes[1].


In ribozyme-assisted polycistronic co-expression system (pRAP)[2], the RNA sequence of ribozyme between coding sequences (CDSs) can conduct self-cleavage and convert polycistron into mono-cistrons in vivo. Self-interaction of the polycistron can be avoided and each mono-cistron can initiate translation with efficiency.

contributed by Fudan iGEM 2023
Figure 1. Principle of pRAP system.

In the pRAP system, stem-loop is a key regulatory element that affects protein concentration by regulating the rate of mRNA degradation [3]. By regulating the intensity of stem-loop, we can control the expression of proteins.

This year, we developed a quantitive pRAP system design software, and we also construct this composite part BBa_K4765129 (stem-loop test) to verify that we can control protein expression by changing stem-loop.

This composite includes T7 promoter, lac promoter, stayGold, Twister P1 (self-cleaving ribozyme), mScarlet, and T7 terminator, which is a stem-loop-deleted version of BBa_K4765120. We inserted different stem-loops between stayGold and Twister P1, and compared the red-green fluorescence intensity ratio to assess the stem-loop's ability to prevent mRNA degradation.

contributed by Fudan iGEM 2023
Figure 2. Biobricks in BBa_K4765129.

Usage and Biology

Using our [http://54.169.242.254:5000/ software], we designed and tested different stem-loops' ability to prevent mRNA degradation, using this composite part. nsl: no stem-loop
liu2023: natural stem-loop from this article
new2/6/10 & old6/10: stem-loops designed by our software with different free energy change of reaction

nsl:     5-AAACACCCACCACAAUUUCCACCGUUU UUUGU-3
liu2023: 5-AAACACCCACCACAAUUUCCACCGUUU CCCGACGCUUCGGCGUCGGG UUUGU-3
new2:    5-AAACACCCACCACAAUUUCCACCGUUU CCCCGUCGGCUGCU UUUGU-3
new6:    5-AAACACCCACCACAAUUUCCACCGUUU AGACGCUCGGCGUCCU UUUGU-3
new10:   5-AAACACCCACCACAAUUUCCACCGUUU ACUGGGGGGAUCGAGGUCUUU UUUGU-3
old6:    5-AAACACCCACCACAAUUUCCACCGUUU AGACGCUCGGCGUCCU UUUGU-3
old10:   5-AAACACCCACCACAAUUUCCACCGUUU GGCGGCGCUACAGCGUCGU UUUGU-3

Characterization

Sequencing Map

contributed by Fudan iGEM 2023
Figure 3. Sequencing result of nsl (no stem-loop before Twister ribozyme cleavage site).
Sanger sequencing verified that we have removed the stem-loop before ribozyme sequence, from BBa_K4765120. We also construct plasmids with stem-loop new2, new6, new10, bad2, bad6, bad10, all of which were designed by our Software RAP, and fully characterized using functional assays.

Microplate Reader Assay

1. Bacterial Culture: Following plasmid transformation and plating, use pipette tip to select monoclonal colony and culture for 24 hrs in a 96-well plate within incubator with gentle aggitation set at 37℃.
2. Sample Preparation: Transfer 25 μL of the bacterial culture from each well into another 96-well plate and dilute them with 75 μL of PBS.
3. Fluorescence Measurement: Use the microplate reader to measure GFP/RFP fluorescence. Set the excitation wavelength at 485/540 nm and the emmison wavelength at 528/620 nm.

contributed by Fudan iGEM 2023
Figure 4. The 96 well plate of bacterial cultures.

Experimental Results

Our experimental findings unveiled a clear connection: as the change in free energy (ΔG) within the reaction decreases, mRNA stability increases, resulting in a higher GFP/RFP ratio. In summary, designing stem-loops with lower ΔG values enhances their ability to shield mRNA from degradation.

contributed by Fudan iGEM 2023
Figure 5. The relationship between the free enegy of stem-loop and GFP/OD and RFP/OD.
contributed by Fudan iGEM 2023
Figure 6. The relationship between the free enegy of stem-loop and mRNA degradation rate.

Summary

In conclusion, this composite part represents a novel attempt to employ 3' stem-loops for regulating mRNA stability. It can to be a better strategy to regulate the protein ratios than changing 5' RBS since it minimizes the likelihood of interfering with the coding sequence (CDS).


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NotI site found at 1389
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 700
    Illegal BsaI.rc site found at 720


Reference

  1. Kim, K.-J., Kim, H.-E., Lee, K.-H., Han, W., Yi, M.-J., Jeong, J., & Oh, B.-H. (2004). Two-promoter vector is highly efficient for overproduction of protein complexes. Protein Science: A Publication of the Protein Society, 13(6), 1698–1703. https://doi.org/10.1110/ps.04644504
  2. Liu, Y., Wu, Z., Wu, D., Gao, N., & Lin, J. (2022). Reconstitution of Multi-Protein Complexes through Ribozyme-Assisted Polycistronic Co-Expression. ACS Synthetic Biology, 12(1), 136–143. https://doi.org/10.1021/acssynbio.2c00416
  3. Newbury, S. F., Smith, N. H., & Higgins, C. F. (1987). Differential mRNA stability controls relative gene expression within a polycistronic operon. Cell, 51(6), 1131–1143. https://doi.org/10.1016/0092-8674(87)90599-x