Difference between revisions of "Part:BBa K4664002"

Revision as of 05:21, 12 October 2023

Padlock-miR-223

Padlock Padlock-miR-223 is the corresponding padlock chosen for the miR-223 biomarker.

Sequence and Features

Background

The padlock probe is essential to our experiments, especially the ligation and rolling circle amplification (RCA) steps. Both of these steps are included in the intermediary assays and our final MB-ERC2 (miRNA biomarker-based exponential RCP Cas12a/CRISPR) system. The general MB-ERC2 schematics is shown below in Figure 1.

Figure 1. MB-ERC2 Reaction Schematics.

Design

Padlock-223 is a 61 bp-long linear single-stranded DNA (ssDNA). It is composed of three sections: the miR-223 binding site (ligation module), crRNA recognition site (Cas12a detection module), and the intermediate sequence. Figure 2 is a visualisation of the padlock probe construct.

Figure 2. Padlock Probe Basic Construct
To optimise the Padlock-223 sequence, we performed experiments with single, double, and triple ligation module mismatches and alternating Cas12a detection module locations (Parts BBa_K4664007 to BBa_K4664023). For results of the optimization experiments, please see registry pages for BBa_K4664007 and BBa_K4664010.
We also performed a series of experiments, aiming to optimise our MB-ERC2 reaction system. These include experimenting with different concentrations of the various reagents used in the assay, trying out different reagents/buffers and buffer concentrations, and the role of RCA amplicon in secondary RCA initiation. More information on these could be found on our Experiments page.
The Cas12a detection module sequence is identical to the crRNA (aside from the difference in T and U). This is due to the crRNA’s complementarity to the RCA amplicon (product of DNA synthesis with the padlock as template). More information on crRNA could be found on the registry page for BBa_K4664005.
Sequence:
TCAAATACACGAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCAACTCAGCTTG

Results

Below are results from the various experiments involving Padlock-223. Figures 3-5 are the intermediary assays three-step and two-step. Figures 6-8 are results from our MB-ERC2 experiments. Figures 9-26 are results obtained from our set of optimisation trials.

Figure 3. Three step assay 500 fM, 100 fM, and 20 fM.

Figure 4. Two step assay 100 pM, 10 pM, and NC.

Figure 5. Two step assay 1 pM, 500 fM, 100 fM, and 20 fM (x-axis is 10-minute cycle).
Before we attempted a one-step, isothermal reaction system, we first tried tandem combinations of ligation, RCA and Cas12a (our intermediary assays experiments). Our first test trial was a three step assay (ligation-RCA-Cas12), lasting approximately 5-6 hours. After that, we attempted a two step method (with ligation and RCA jointly carried out instead of separately, as in the three step assay), which shortened the reaction time to 3-4 hours. Then, after both intermediary assays yielded satisfactory results (as shown in Figures 3-5), we began testing a one-step reaction.

Figure 6. MB-ERC2, 1 nM and 100 pM (x-axis is 10-minute cycle).

Figure 7. MB-ERC2 10 pM, 1 pM, and 500 fM.

Figure 8. MB-ERC2 100 fM and 20 fM.
After the success of our MB-ERC2 system (based on the EXTRA-CRISPR system devised by He et al. (2023)), we began a series of optimization experiments to investigate the effects of different concentration reagents/different reagents on reaction outcomes.

Phi 29 Poymerase

Phi29 polymerase is important in terms of facilitating the amplification in RCA (i.e. synthesis of the DNA strand complementary to the padlock). On the basis of our standard concentration (0.1 U/µl), we tested NC, 0.05 U/µl, 0.15 U/µl, 0.2 U/µl, and 0.5 U/µl

Figure 9. Phi 29 concentration 1 pM.

Figure 10. Phi 29 concentration 10 pM.

Figure 11. Phi 29 concentration final values.

Ribonucleoprotein (RNP)

Cas12a cleavages significantly influence the outcome of the reactions. Cis-cleavages are important for the initiation of secondary RCAs, thus promoting exponential amplification. Trans-cleavages are vital in terms of expression of the fluorescence signals. Thus, it is important to determine the optimal amount of RNP required to best enhance reaction kinetics. Our standard RNP concentration is 1 nM, thus, we tested the MB-ERC2 system with varied RNP concentrations of NC, 0.5 nM, 2.5 nM, 4 nM, and 5 nM.