Difference between revisions of "Part:BBa K4683003:Design"
Natalietan (Talk | contribs) |
Natalietan (Talk | contribs) |
||
Line 1: | Line 1: | ||
− | + | <partinfo>BBa_K468300short</partinfo> | |
− | <partinfo> | + | |
− | <partinfo> | + | <partinfo>BBa_K468300 SequenceAndFeatures</partinfo> |
Revision as of 03:03, 11 October 2023
No part name specified with partinfo tag.
No part name specified with partinfo tag.
Design Notes
Original sequence of hsa-miR-1-3p: UGGAAUGUAAAGAAGUAUGUAU
rs1555902771:UGGAAUGUAAAGAAGUAUGUGU (SingleNucleotideVariant- A–>G)
Source
Variation IDs: rs377171105 + rs1991218200 + rs1555902769 from the National Library of Medicine microRNA 1-1database