Difference between revisions of "Part:BBa K4593006"

 
Line 3: Line 3:
 
<partinfo>BBa_K4593006 short</partinfo>
 
<partinfo>BBa_K4593006 short</partinfo>
  
After detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.
+
This part is the DNA sequence of PA#2/8-A
 +
 
 +
ACCAGCTTATTCAATTAGCAACATG
  
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
 +
After detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.
 +
 +
==Team: BNDS-China 2023==
 +
 +
Our project aims to create a suite of effective methods for both detecting and lysing S. aureus in vivo. Also, after detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.
 +
 +
====Design of PA#2/8-A ====
 +
 +
We employed a computational approach using the trained BERT language model in a dry lab setting. Through this screening of large amount of aptamer mutants, we discovered this aptamer as effective. We added biotin at the 3’ end to test the affinity of the aptamer
 +
 +
 +
Figure 1. The simulated 2D structure of PA#2/8-A
 +
 +
====Examining the binding affinity of PA#2/8-A to Protein A====
 +
 +
We utilized ELONA to verify the binding affinity of PA#2/8 and its truncates to protein A. Table 1 lists the experimental and control groups. The aptamer-only groups were used to exclude background luminescence. The full-length aptamer was used for comparison with the three truncates to determine the optimal aptamer with the highest binding affinity.
 +
 +
Table 1. The experimental and control groups' setting
 +
 +
 +
The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 3. The PA#2/8-E truncate has the strongest binding affinity, and all three truncates have been successfully designed to improve the aptamer-protein binding affinity (Figure 2.)
 +
 +
 +
 +
 +
Figure 2. The comparison of binding affinity between four aptamers
 +
 +
  
 
<!-- -->
 
<!-- -->

Revision as of 15:03, 9 October 2023


PA#2/8-A

This part is the DNA sequence of PA#2/8-A

ACCAGCTTATTCAATTAGCAACATG

Usage and Biology

After detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.

Team: BNDS-China 2023

Our project aims to create a suite of effective methods for both detecting and lysing S. aureus in vivo. Also, after detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.

Design of PA#2/8-A

We employed a computational approach using the trained BERT language model in a dry lab setting. Through this screening of large amount of aptamer mutants, we discovered this aptamer as effective. We added biotin at the 3’ end to test the affinity of the aptamer


Figure 1. The simulated 2D structure of PA#2/8-A

Examining the binding affinity of PA#2/8-A to Protein A

We utilized ELONA to verify the binding affinity of PA#2/8 and its truncates to protein A. Table 1 lists the experimental and control groups. The aptamer-only groups were used to exclude background luminescence. The full-length aptamer was used for comparison with the three truncates to determine the optimal aptamer with the highest binding affinity.

Table 1. The experimental and control groups' setting


The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 3. The PA#2/8-E truncate has the strongest binding affinity, and all three truncates have been successfully designed to improve the aptamer-protein binding affinity (Figure 2.)



Figure 2. The comparison of binding affinity between four aptamers


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]