Difference between revisions of "Part:BBa K4634014"
 
Line 18: Line 18:
 
<!-- -->
 
<!-- -->
  
−
===References===
+
<html>
 +
<h2>Characterization</h2>
 +
 
 +
<h3>Functional Verification</h3>
 +
 
 +
<p>We have validated the functionality of OmpA signal peptide.We designed and constructed plasmid pET-28a-OmpA-mCherry (Figure 1)in which OmpA was fused to the N terminal of mCherry. Plasmid was transformed into the BL21. OmpA-mCherry expression was induced by 1mM IPTG. The induced cultures were centrifuged, and the supernatant was collected and filtered. The secretion level of mCherry was determined by ELISA reader.Results demonstrated that mCherry can be successfully secreted, indicating that OmpA served as a reliable signal peptide for secretion. (Figure 2)</p>
 +
 
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634014-1.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634014-1.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634014-1.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Figure 1. Plasimid profile of pET-28a-OmpA-mCherry.</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 
 +
<div class="center">
 +
    <div class="thumb tnone">
 +
        <div class="thumbinner" style="width:50%;">
 +
            <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634014-2.jpg" class="image">
 +
                <img alt="" src="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634014-2.jpg" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 +
                <div class="magnify">
 +
                    <a href="https://static.igem.wiki/teams/4634/wiki/parts-registry/bba-k4634014-2.jpg" class="internal" title="Enlarge"></a>
 +
                </div>
 +
                <b>Figure 2. Secretion of OmpA-mCherry.</b>
 +
               
 +
            </div>
 +
        </div>
 +
    </div>
 +
</div>
 +
 
 +
<h3>Design Considerations</h3>
 +
<p>The sequence of OmpA is MKKTAIAIAVALAGFATVAQA.Using the GeneOptimizer online tool developed by ThermoFisher, we performed codon optimization and converted the protein sequence of OmpA into a DNA sequence (ATGAAAAAGACCGCAATTGCCATTGCAGTTGCACTGGCAGGTTTTGCAACCGTTGCACAGGCA) which is most suitable for expression in Escherichia coli.</p>
 +
<p>OmpA signal peptide should be fused at the N terminal of target protein.</p>
 +
 
 +
<h2>References</h2>
 
[1] Movva NR, Nakamura K, Inouye M. Amino acid sequence of the signal peptide of ompA protein, a major outer membrane protein of Escherichia coli. J Biol Chem. 1980 Jan 10;255(1):27-9. PMID: 6985608.<br/>
 
[1] Movva NR, Nakamura K, Inouye M. Amino acid sequence of the signal peptide of ompA protein, a major outer membrane protein of Escherichia coli. J Biol Chem. 1980 Jan 10;255(1):27-9. PMID: 6985608.<br/>
 
[2] Pechsrichuang P, Songsiriritthigul C, Haltrich D, Roytrakul S, Namvijtr P, Bonaparte N, Yamabhai M. OmpA signal peptide leads to heterogenous secretion of B. subtilis chitosanase enzyme from E. coli expression system. Springerplus. 2016 Jul 28;5(1):1200. doi: 10.1186/s40064-016-2893-y. PMID: 27516938; PMCID: PMC4963352.
 
[2] Pechsrichuang P, Songsiriritthigul C, Haltrich D, Roytrakul S, Namvijtr P, Bonaparte N, Yamabhai M. OmpA signal peptide leads to heterogenous secretion of B. subtilis chitosanase enzyme from E. coli expression system. Springerplus. 2016 Jul 28;5(1):1200. doi: 10.1186/s40064-016-2893-y. PMID: 27516938; PMCID: PMC4963352.
 +
</html>

Latest revision as of 14:00, 9 October 2023


OmpA signal peptide

The OmpA signal peptide is a short amino acid sequence found at the N-terminus of the OmpA protein in Gram-negative bacteria. The primary function of the OmpA signal peptide is to guide the nascent OmpA protein to the appropriate cellular compartment, which is the outer membrane in this case. The signal peptide acts as a recognition signal for the protein translocation machinery present in the bacterial cell. When fused to the N-terminus of other proteins, it has the ability to facilitate the secretion of those proteins.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Characterization

Functional Verification

We have validated the functionality of OmpA signal peptide.We designed and constructed plasmid pET-28a-OmpA-mCherry (Figure 1)in which OmpA was fused to the N terminal of mCherry. Plasmid was transformed into the BL21. OmpA-mCherry expression was induced by 1mM IPTG. The induced cultures were centrifuged, and the supernatant was collected and filtered. The secretion level of mCherry was determined by ELISA reader.Results demonstrated that mCherry can be successfully secreted, indicating that OmpA served as a reliable signal peptide for secretion. (Figure 2)

Figure 1. Plasimid profile of pET-28a-OmpA-mCherry.
Figure 2. Secretion of OmpA-mCherry.

Design Considerations

The sequence of OmpA is MKKTAIAIAVALAGFATVAQA.Using the GeneOptimizer online tool developed by ThermoFisher, we performed codon optimization and converted the protein sequence of OmpA into a DNA sequence (ATGAAAAAGACCGCAATTGCCATTGCAGTTGCACTGGCAGGTTTTGCAACCGTTGCACAGGCA) which is most suitable for expression in Escherichia coli.

OmpA signal peptide should be fused at the N terminal of target protein.

References

[1] Movva NR, Nakamura K, Inouye M. Amino acid sequence of the signal peptide of ompA protein, a major outer membrane protein of Escherichia coli. J Biol Chem. 1980 Jan 10;255(1):27-9. PMID: 6985608.
[2] Pechsrichuang P, Songsiriritthigul C, Haltrich D, Roytrakul S, Namvijtr P, Bonaparte N, Yamabhai M. OmpA signal peptide leads to heterogenous secretion of B. subtilis chitosanase enzyme from E. coli expression system. Springerplus. 2016 Jul 28;5(1):1200. doi: 10.1186/s40064-016-2893-y. PMID: 27516938; PMCID: PMC4963352.