Difference between revisions of "Part:BBa K203119:Design"

(Design Notes)
(Design Notes)
Line 7: Line 7:
 
===Design Notes===
 
===Design Notes===
  
[http://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters RA-PCR] (Fig. 2) was conducted with Oligos containing a NF-κB binding site, plus a small number of "general activators" (NF-Y, Sp1, Ap1, CREB). 33 clones were picked, miniprepped and transfected. NF-κB was then induced by the addition of TNF-&alpha (2.5µM) for 10 hours, and left uninduced as a control. The plate was then scanned by TECAN, an automated fluorescence plate reader. TECAN is very imprecise on eukaryotic cells, and the arbitrary fluorescence we meausred is not proportional to [http://2009.igem.org/Team:Heidelberg/Project_Measurement REU] or another precise measure of mammalian promoter activity, but it can serve as a rough indicator of promoter induction. The result (Fig. 1) shows that most clones appear not to be induced by NF-κB, whereas others are induced at varying levels of strength. We picked clone 31 for submission to the registry and detailed characterization.
+
[http://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters RA-PCR] (Fig. 2) was conducted with Oligos containing a NF-κB binding site, plus a small number of "general activators" (NF-Y, Sp1, Ap1, CREB) (for exact amount of Oligos used, see table below). 33 clones were picked, miniprepped and transfected. NF-κB was then induced by the addition of TNF-&alpha (2.5µM) for 10 hours, and left uninduced as a control. The plate was then scanned by TECAN, an automated fluorescence plate reader. TECAN is very imprecise on eukaryotic cells, and the arbitrary fluorescence we meausred is not proportional to [http://2009.igem.org/Team:Heidelberg/Project_Measurement REU] or another precise measure of mammalian promoter activity, but it can serve as a rough indicator of promoter induction. The result (Fig. 1) shows that most clones appear not to be induced by NF-κB, whereas others are induced at varying levels of strength. We picked clone 31 for submission to the registry and detailed characterization.
 +
 
 +
{|
 +
|-
 +
!Oligo name
 +
!Oligo Sequence
 +
!µL of Oligo used
 +
|-
 +
|NFkB responsive forward 1
 +
|GCGATCGGCAGATCAGGGGACTTTGCCGGGTGACGGGTTCA
 +
|3
 +
|}
 +
 
  
 
[[Image:HD09_nfkb.png|thumb|none|600px|'''Fig. 1: Screening of putatively NF-κB inducible promoters''']]  
 
[[Image:HD09_nfkb.png|thumb|none|600px|'''Fig. 1: Screening of putatively NF-κB inducible promoters''']]  

Revision as of 13:18, 20 October 2009

NfKB Responsive promoter


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

[http://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters RA-PCR] (Fig. 2) was conducted with Oligos containing a NF-κB binding site, plus a small number of "general activators" (NF-Y, Sp1, Ap1, CREB) (for exact amount of Oligos used, see table below). 33 clones were picked, miniprepped and transfected. NF-κB was then induced by the addition of TNF-&alpha (2.5µM) for 10 hours, and left uninduced as a control. The plate was then scanned by TECAN, an automated fluorescence plate reader. TECAN is very imprecise on eukaryotic cells, and the arbitrary fluorescence we meausred is not proportional to [http://2009.igem.org/Team:Heidelberg/Project_Measurement REU] or another precise measure of mammalian promoter activity, but it can serve as a rough indicator of promoter induction. The result (Fig. 1) shows that most clones appear not to be induced by NF-κB, whereas others are induced at varying levels of strength. We picked clone 31 for submission to the registry and detailed characterization.

Oligo name Oligo Sequence µL of Oligo used
NFkB responsive forward 1 GCGATCGGCAGATCAGGGGACTTTGCCGGGTGACGGGTTCA 3


Fig. 1: Screening of putatively NF-κB inducible promoters
Fig. 2: The method of LAM-PCR. For a detailled description, see [http://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters our wiki]

Source

Synthesized in our laboratory.

References

RA-PCR, a method for the generation of randomized promoter libraries. igem 2009 Heidelberg team wiki. Available online at http://2009.igem.org/Team:Heidelberg/Project_Synthetic_promoters#Results