Difference between revisions of "Part:BBa K4768000"
Line 39: Line 39:
 
<p> The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells. </p>
 
<p> The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells. </p>
 
Primers used to clone this part in the pET21: (from 5' to 3'):
 
Primers used to clone this part in the pET21: (from 5' to 3'):
 +
 +
<ol>
 +
    <i> DhdR-pET21-F: AGCAGCCGGATCTCATCATGACGTCTGACGCGC
 +
    <i> DhdR-pET21-R: GAAGGAGATATACATATGGGCCATCATCATCATCATC
 +
</ol>
 +
 +
<p>Figure 2 shows the enzymatic restriction pattern of the resulting clones. Clone 4 was digested using EcoRV and NdeI. Two bands were expected at 1.3 kb and 4.8 kb, as experimentally measured (lane 5).</p>
 +
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img
 +
            class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/registry/cloning-dhdr-part.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: Enzymatic digestion of the plasmid part</b>extracted from clone 4. Patterns from simple digestion by EcoRV or by NdeI, and double digestion by both enzymes are shown.
 +
</i></span></figcaption>
 +
        </figure>
 +
</div>
 +
 +
<p>Clone 4 was sequence verified.</p>
 +
 +
<h2>Characterization</h2>
 +
 +
<h3>1)Production and purification of DhdR</h3>
 +
 +
<p>The pET21a(+) vector including the <i>dhdR<i> insert was transformed into <i>E.coli</i> strain BL21 (DE3). This strain was provided by Cédric Montanier (researcher at TBI). When DO reaches 0.5-0.6, expression of the recombinant protein was induced overnight at 16°C using IPTG. The His-tagged protein was then purified on TALON® Metal Affinity Resin. Pure fractions were assessed by SDS-PAGE.Results are shown in Figure 3.</p>
 +
 +
<div align="center">
 +
        <figure class="normal mx-auto">   
 +
            <img
 +
            class="d-block"
 +
            style="width:90%;"
 +
            src="https://static.igem.wiki/teams/4768/wiki/module-2/gel-dhdr-wiki.jpg">
 +
            <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: SDS-PAGE analysis of the different steps of the DhdR purification: protein ladder (SE250 Mighty Small II Mini Vertical Protein Electrophoresis Unit), pellet DhdR, cell-free extract (CFE), flowthrough (FT), wash (W), elution with 50 mM imidazole, 100 mM imidazole, 250 mM imidazole and 500 mM imidazole (respectively E1<sub>50</sub>, E1<sub>100</sub>, E1<sub>250</sub> and E1<sub>500</sub>). The band corresponding to the protein was clearly identified by Coomassie Blue staining.</b>
 +
</i></span></figcaption>
 +
                                               
 +
</figure>
 +
 +
</div>
 +
 +
<p>The E1<sub>250</sub> fraction was dialysed leading to a concentration of 14.4 µM (> 95% pure protein). Fractions E1<sub>100</sub> and E1<sub>500</sub> were pooled and dialysed, resulting in a concentration of 7.63 µM (> 95% pure protein).</p>
 +
 +
  
  

Revision as of 16:21, 8 October 2023


DhdR repressor

Part for expression and purification of our transcriptional repressor DhdR for biosensing.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 47
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 493
    Illegal BglII site found at 622
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 47
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 756


xxxxxxxxxxxxxxxxxxadd part imagexxxxxxxxxxxxx

Introduction

The CALIPSO part (BBa_K4768000) consists of the transcriptional repression factor, DhdR, which has been isolated from the bacterium Achromobacter denitrificans. The codon sequence has been optimized for expression in E.coli. Additionally, the presence of a T7 promoter and terminator enables its inducible expression by IPTG in E.coli BL21 (DE3). Finally, a Histidine tag is included in the sequence to facilitate the purification of DhdR.

This transcriptional repressor was employed in our biosensing system, which was inspired by the work of Ping Xu et al. 1 and the work conducted by iGEM Duke 2021. Our objective was to use the affinity between 2-Hydroxyglutarate, an oncometabolite, and DhdR to trigger the production of our drug-activating enzyme when liposomes are situated in a tumoral environment. To achieve this, we positioned our gene of interest under the control of the operator site of DhdR, referred to as dhdO.

<b>Figure 1: Functioning of our biosensor.</b> In presence of 2-HG, the repression is removed and the gene is expressed leading to the production of the thymidine phosphorylase which converts our Tegafur prodrug into an active anticancer drug, 5-fluorouracile.Figure 1: Functioning of our biosensor. In presence of 2-HG, the repression is removed and the gene is expressed leading to the production of the thymidine phosphorylase which converts our Tegafur prodrug into an active anticancer drug, 5-fluorouracile.

Construction

The CALIPSO part BBa_K4768000 comprises the transcriptional repression factor DhdR fused with a histidine tag at its N-terminus. The synthesis of this gBlock was performed and provided by IDT.

The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells.

Primers used to clone this part in the pET21: (from 5' to 3'):
    DhdR-pET21-F: AGCAGCCGGATCTCATCATGACGTCTGACGCGC DhdR-pET21-R: GAAGGAGATATACATATGGGCCATCATCATCATCATC

Figure 2 shows the enzymatic restriction pattern of the resulting clones. Clone 4 was digested using EcoRV and NdeI. Two bands were expected at 1.3 kb and 4.8 kb, as experimentally measured (lane 5).

Figure 2: Enzymatic digestion of the plasmid partextracted from clone 4. Patterns from simple digestion by EcoRV or by NdeI, and double digestion by both enzymes are shown.

Clone 4 was sequence verified.

Characterization

1)Production and purification of DhdR

The pET21a(+) vector including the dhdR insert was transformed into E.coli strain BL21 (DE3). This strain was provided by Cédric Montanier (researcher at TBI). When DO reaches 0.5-0.6, expression of the recombinant protein was induced overnight at 16°C using IPTG. The His-tagged protein was then purified on TALON® Metal Affinity Resin. Pure fractions were assessed by SDS-PAGE.Results are shown in Figure 3.

Figure 1: SDS-PAGE analysis of the different steps of the DhdR purification: protein ladder (SE250 Mighty Small II Mini Vertical Protein Electrophoresis Unit), pellet DhdR, cell-free extract (CFE), flowthrough (FT), wash (W), elution with 50 mM imidazole, 100 mM imidazole, 250 mM imidazole and 500 mM imidazole (respectively E150, E1100, E1250 and E1500). The band corresponding to the protein was clearly identified by Coomassie Blue staining.

The E1250 fraction was dialysed leading to a concentration of 14.4 µM (> 95% pure protein). Fractions E1100 and E1500 were pooled and dialysed, resulting in a concentration of 7.63 µM (> 95% pure protein).

Molecular Modeling

TXXXXXX.

Characterisation

TXXXXXX.

Conclusion and Perspectives

TXXXXXX.

References

  1. article 1 xxxxxxxx
  2. article 2 xxxxxxx
    3.