Difference between revisions of "Part:BBa K4586017"
Ahmed Mattar (Talk | contribs) |
Ahmed Mattar (Talk | contribs) |
||
Line 7: | Line 7: | ||
==Usage== | ==Usage== | ||
It is a promoter that controls the production of the guide RNA that directs Cas12k to the target. | It is a promoter that controls the production of the guide RNA that directs Cas12k to the target. | ||
+ | ==Literature Characterization== | ||
+ | The study made an analysis of the site of transcription initiation, which was driven by the U6 promoter. | ||
+ | <html><div align="center"style="border:solid #17252A; width:75%;float:center;"><img style=" max-width:850px; | ||
+ | width:100%; | ||
+ | height:auto; | ||
+ | position: relative; | ||
+ | top: 50%; | ||
+ | left: 35%; | ||
+ | transform: translate( -50%); | ||
+ | padding-bottom:25px; | ||
+ | padding-top:25px; | ||
+ | "src="https://static.igem.wiki/teams/4586/wiki/literature-characterisation-parts/u6-promoter.png"> | ||
+ | <p class=MsoNormal align=center style='text-align:left;border:none;width:98% ;justify-content:center;'><span | ||
+ | lang=EN style='font-size:11.0pt;line-height:115%'>T(a) Here we have the transcription initiation site for sh1005 serial mutations. The nucleotides that replace the A in position -1 of sh1005 are identified by lowercase letters. and in boxes we have the presumed initiation site of transcription. The red mark is the real initiation site; the bold mark The original SH1005 (b) They made the dual-luciferase assay to assess the functionality of sh1005 serial mutations. (c) The transcription initiation site for small RNAs (~21 nt in length), in which the nucleotides around the initiation site are different. nucleotides added between the -2 position of the U6 promoter and the universal sequence GATAATTTGTGGTAGTGGTT are referred to by lowercase letters. Asterisks are used to assess constructs for which an insufficient number of reads were sequenced to indicate the exact initiation site. (d) transcription initiation is affected by the sequence upstream of the -1 site. Red mark The initiation sites of the indicated sh1005 mutations with changed sequences upstream of the -1 siteز | ||
+ | </span></p></div></html> | ||
+ | ==References== | ||
+ | Ma, H., Wu, Y., Dang, Y., Choi, J. G., Zhang, J., & Wu, H. (2014). Pol III promoters to express small RNAs: delineation of transcription initiation. Molecular Therapy-Nucleic Acids, 3. | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
===Usage and Biology=== | ===Usage and Biology=== |
Revision as of 16:14, 24 September 2023
Human U6 promoter
Part Description
It is a type III RNA polymerase III promoter that controls the expression of short RNAs. Distance sequence element (DSE), proximal sequence element (PSE), and TATA box are the three primary components of the U6 promoter. The nucleotide G indicates the U6 promoter's transcriptional beginning location.
Usage
It is a promoter that controls the production of the guide RNA that directs Cas12k to the target.
Literature Characterization
The study made an analysis of the site of transcription initiation, which was driven by the U6 promoter.
T(a) Here we have the transcription initiation site for sh1005 serial mutations. The nucleotides that replace the A in position -1 of sh1005 are identified by lowercase letters. and in boxes we have the presumed initiation site of transcription. The red mark is the real initiation site; the bold mark The original SH1005 (b) They made the dual-luciferase assay to assess the functionality of sh1005 serial mutations. (c) The transcription initiation site for small RNAs (~21 nt in length), in which the nucleotides around the initiation site are different. nucleotides added between the -2 position of the U6 promoter and the universal sequence GATAATTTGTGGTAGTGGTT are referred to by lowercase letters. Asterisks are used to assess constructs for which an insufficient number of reads were sequenced to indicate the exact initiation site. (d) transcription initiation is affected by the sequence upstream of the -1 site. Red mark The initiation sites of the indicated sh1005 mutations with changed sequences upstream of the -1 siteز
References
Ma, H., Wu, Y., Dang, Y., Choi, J. G., Zhang, J., & Wu, H. (2014). Pol III promoters to express small RNAs: delineation of transcription initiation. Molecular Therapy-Nucleic Acids, 3. Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]