Difference between revisions of "Part:BBa K4729500"

Revision as of 11:32, 10 October 2023

virG CDS (A. tumefaciens)

General explanation of virulence

The mechanism for virulence and plant transformation is mostly conserved between A. tumefaciens and A. rhizogenes, with high similarity in the sequences of the virulence genes and their regulation (Moriguchi et al., 2001; Zhu et al., 2000). Therefore, most of the knowledge already available for A. tumefaciens can be extrapolated when working with rhizogenes strains. In fact, the swapping of Ti-plasmids in tumefaciens strains with Ri-plasmids has created some of the most commonly used Agrobacterium rhizogenes strains, including one of the strains used by our team, Arqua1.

The Virulence Mechanism

Agrobacterium strains can transfer large DNA sequences to plant cells and integrate them into the plants' genome. Naturally, all the components for infection are present in a single, non-essential, 250 kbp plasmid (Ti-plasmid in A. tumefaciens or Ri-plasmid in A. rhizogenes).

The genes that code for the mechanism of plant infection and transformation are clustered in the vir (virulence) region, a ~30 kbp region of the Ri-plasmid. There are ca. 35 CDSs distributed in 11 operons in the vir region, which code for - among others - the type IV secretion system (vir B operon), proteins that excise and integrate the T-DNA in the hosts genome (C,D and E operons), and the two-component system that regulates the activation of the whole system (A and G operons). This two-component system can be understood as a “master switch” for the virulence genes.

Vir A is a trans-membrane sensor kinase that reacts to an acidic pH and phenolic compounds secreted by wounded plant tissue, causing it to phosphorylate the response regulator vir G. Among those phenolic compounds are acetosyringone, catechol and vanillin (Bolton et al., 1986). Once phosphorylated, vir G binds to the vir box region (TGAAAT) present in the promoters of virulence operons and upregulates their expression (Aoyama et al., 1989).

virG(N54D)

The phosphorylation of vir G is, however, not strictly necessary for it to activate the transcription of virulence genes. Virulence has been induced in Agrobacterium strains lacking vir A completely, when a mutant version of vir G is introduced. The change of one amino acid at position 54 from an asparagine (N) to aspartate (D) results in a “costituitve phenotype” of vir G, which does not need to be phosphorylated by vir A to induce virulence (Jin et al., 1993). Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
INCOMPATIBLE WITH RFC[21]
Illegal BamHI site found at 332
Illegal BamHI site found at 624
Illegal XhoI site found at 271
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

@@ Line 3: / Line 3: @@
 <partinfo>BBa_K4729500 short</partinfo>
-AAACACGTTCTTGTCATCGATGACGATGTCGCTATGCGGCATCTTATAGTCGAGTATCTTACCATCCATGCCTTTAAGGTGACGGCGGTAGCCGACAGCAAGCAGTTCAATCGTGTACTTTCCTCCGAGACTGTCGATGTCGCGGTTGTCGATCTTAATTTGGGTCGCGAAGATGGGCTTGAAATTGTTCGCACTCTGGCGACAAAATCCGATGTTCCAATGATAATCATTAGCGGTGATCGGCTTGAGGAGGCGGACAAAGTTGTTGCACTCGAGCTGGGAGCAACCGATTTTATCGCCAAACCTTTTGGGACCCGCGAATTTCTGGCGCGGATCCGTGTTGCGTTGCGCGAGCGGCCCAGCGTCGCGCGTACGAAAGACCGACGCTCATTTTATTTCGCAGACTGGACACTGAATATCAGGCAACGCCGTTTGATTTCGGAAGAGGGCGGAGAGATTAAACTCACGGCAGGTGAGTTTAATCTTCTTGTCGCCTTCCTGGAGAAGCCGCGCGACGTTCTATCCCGCGAGCAGCTTCTGATCGCCAGTCGGGTGAGAGAGGAGGAGGTGTATGACAGAAGTATTGACGTCCTCATTTTACGGCTGCGCCGAAAGCTTGAGGGGGATCCGACAAGCCCCCAGTTGATCAAGACTGCAAGAGGTGCTGGCTATTTCTTTGACGCGGACGTCAACGTTTCCTACGGGGGTATGATGGCGGCC
+==General explanation of virulence==
+The mechanism for virulence and plant transformation is mostly conserved between A. tumefaciens and A. rhizogenes, with high similarity in the sequences of the virulence genes and their regulation (Moriguchi et al., 2001; Zhu et al., 2000). Therefore, most of the knowledge already available for A. tumefaciens can be extrapolated when working with rhizogenes strains. In fact, the swapping of Ti-plasmids in tumefaciens strains with Ri-plasmids has created some of the most commonly used Agrobacterium rhizogenes strains, including one of the strains used by our team, Arqua1.
+==The Virulence Mechanism==
+Agrobacterium strains can transfer large DNA sequences to plant cells and integrate them into the plants' genome. Naturally, all the components for infection are present in a single, non-essential, 250 kbp plasmid  (Ti-plasmid in A. tumefaciens or Ri-plasmid in A. rhizogenes).
+The genes that code for the mechanism of plant infection and transformation are clustered in the vir (virulence) region, a ~30 kbp region of the Ri-plasmid. There are ca. 35 CDSs distributed in 11 operons in the vir region, which code for - among others - the type IV secretion system (vir B operon),  proteins that excise and integrate the T-DNA in the hosts genome (C,D and E operons), and the two-component system that regulates the activation of the whole system (A and G operons). This two-component system can be understood as a “master switch” for the virulence genes.
+Vir A is a trans-membrane sensor kinase that reacts to an acidic pH and phenolic compounds secreted by wounded plant tissue, causing it to phosphorylate the response regulator vir G. Among those phenolic compounds are acetosyringone, catechol and vanillin (Bolton et al., 1986). Once phosphorylated, vir G binds to the vir box region (TGAAAT) present in the promoters of virulence operons and upregulates their expression (Aoyama et al., 1989).
+==virG(N54D)==
+The phosphorylation of vir G is, however, not strictly necessary for it to activate the transcription of virulence genes. Virulence has been induced in Agrobacterium strains lacking vir A completely, when a mutant version of vir G is introduced. The change of one amino acid at  position 54 from an asparagine (N) to aspartate (D) results in a “costituitve phenotype” of vir G, which does not need to be phosphorylated by vir A to induce virulence  (Jin et al., 1993).
 <!-- Add more about the biology of this part here
 ===Usage and Biology===