Difference between revisions of "Part:BBa K4417001"

Line 30: Line 30:
 
[[File:Zjy13.png|700px|thumb|center|'''Figure 3:''' Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadder<sup>TM</sup> 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadder<sup>TM</sup> 1kb.]]
 
[[File:Zjy13.png|700px|thumb|center|'''Figure 3:''' Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadder<sup>TM</sup> 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadder<sup>TM</sup> 1kb.]]
  
 +
 +
<h1>Conclusion</h1>
 +
 +
This part has high efficiency and quality in site directed mutagenesis.
  
 
<!-- -->
 
<!-- -->

Revision as of 09:22, 12 October 2022


SDM1 Forward Primer for pCT5c Mutation

Description

This primer is designed for mutating the BsaI site 1 in pCT5-bac 2.0. This part is a forward primer with a mutation nucleotide, changing c to g.

Figure 1: pCT5-bac 2.0 with primers for site directed mutagenesis at position 647.


Usage and Biology

  • This part is used in site directed mutagenesis of pCT5c (Part: BBa_K4417000).
  • Sequence: tgccctgggtttccattgcgc
  • Length: 21-mer
  • Tm: 61℃
  • GC content: 62%
Figure 2: Binding site of SDM1_Fw.

Method

This part is used with BBa_K4417000 and BBa_K4417002. A detailed protocol is described in BBa_K4417000.

Characterization

This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15.

Figure 3: Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadderTM 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadderTM 1kb.


Conclusion

This part has high efficiency and quality in site directed mutagenesis.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]