Difference between revisions of "Part:BBa K4441003"

Latest revision as of 05:35, 12 October 2022

BRAF WT BIP

Sequence used in wetlab experiments: AACAGTTGTCTGGATCCATTTTGTGACATCTGACTGAAAGCTGTA is taken from [1]

Usage and Biology

This is the sequence for the Backward Inner Primer (BIP). The BIP consists of a B2 region at the 3'end and a B1c region at the 5'end [2]. The B2 region is complementary to the B2c region of the template sequence. The B1c region is identical to the B1c region of the template sequence [w]. This BIP primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG

Dilutions

Storage Primer Concentration: 100 μM

10X Concentration (Stock): 16 μM

Volume of 10X primer mix: 10 μL

1X Concentration (Final): 1.6 μM

Volume of storage primer needed: 1.6 μL

Mixed with F3, B3, FIP for a total of 3.6 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington

Citations

1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996.

2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html Sequence and Features