Difference between revisions of "Part:BBa K4274008"
Line 16: | Line 16: | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
− | + | ==Sequence and Features== | |
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> | ||
<partinfo>BBa_K4274008 SequenceAndFeatures</partinfo> | <partinfo>BBa_K4274008 SequenceAndFeatures</partinfo> |
Revision as of 04:51, 12 October 2022
sfp_target(gRNA)
tcgggaagatcagggatgca
Guide RNA (gRNA) is used as a molecule that helps with the cleavage of DNA since it guides the Cas nuclease to a targeted dsDNA sequence. As a gRNA, sfp_target is used for knocking-out the natural, invalid sfp gene, and then knocking-in sfp (Part number:BBa_K4274009) and degQ(Part number:BBa_K4274010) gene in the genome of Bacillus subtilis.
Usage and biology
Single-guide RNA (sgRNA) is RNA designed artifially to be able to bind to a DNA sequence. It combines with the Cas9 protein to work to cleave the target RNA and though it is slightly shorter, it has the same function as the original RNAs in the CRISPR/Cas9 system. We designed the sfp_target(gRNA) to target the region of the natural sfp gene to knock-out and simultaneously knock-in sfp (Part number:BBa_K4274009) and degQ (Part number:BBa_K4274010) gene in situ. After the sucessful modification, Bacillus subtilis 168 was allowed to produce fengycins. This could be reused by other teams to edit the genome of Bacillus subtilis and thus realize fengycins’ production.
Source
Bacillus subtilis