Difference between revisions of "Part:BBa K4491007"
Line 147: | Line 147: | ||
=== Experimental design === | === Experimental design === | ||
− | |||
To test the designed araBAD promoters, we cloned nine respective Level 0 promoter parts into Level 1 JUMP constructs [], using a standard Golden Gate Assembly protocol with BsaI-HFv2. Lying downstream of the promoter is a B0032 medium RBS, an mVenus reporter and a DT5 double terminator. A medium-strength RBS was chosen to avoid burden caused by accidental overexpression of mVenus. All TUs were put into a pJUMP27-1A destination vector. The low copy number plasmid makes it favourable for avoiding phototoxicity and aggregate bodies, as well as reducing noise. A list of constructs ID and their respective constituent promoter is given below. | To test the designed araBAD promoters, we cloned nine respective Level 0 promoter parts into Level 1 JUMP constructs [], using a standard Golden Gate Assembly protocol with BsaI-HFv2. Lying downstream of the promoter is a B0032 medium RBS, an mVenus reporter and a DT5 double terminator. A medium-strength RBS was chosen to avoid burden caused by accidental overexpression of mVenus. All TUs were put into a pJUMP27-1A destination vector. The low copy number plasmid makes it favourable for avoiding phototoxicity and aggregate bodies, as well as reducing noise. A list of constructs ID and their respective constituent promoter is given below. | ||
Line 163: | Line 162: | ||
Both experiments would involve measuring mVenus fluorescence intensity (FI) of transformed Marionettes grown under varying arabinose concentrations. FI was measured using a ClarioStar plate reader, on Greiner F-bottom 96-well plates or standard Greiner 384-well plates. | Both experiments would involve measuring mVenus fluorescence intensity (FI) of transformed Marionettes grown under varying arabinose concentrations. FI was measured using a ClarioStar plate reader, on Greiner F-bottom 96-well plates or standard Greiner 384-well plates. | ||
+ | === Results === | ||
====Two-Level factorial screen==== | ====Two-Level factorial screen==== | ||
We first investigated the leakiness and maximal strength of the eight P_BADs. We chose arabinose concentrations of 0 uM and 1000 uM as the testing conditions. We shall, for now, not take Hill’s dynamics into account, and focus solely on the two concentration endpoints that best showcase the promoters’ two characteristics. We also calculated the fold-change (or fold-induction), defined as the ratio of maximal expression to leakiness: | We first investigated the leakiness and maximal strength of the eight P_BADs. We chose arabinose concentrations of 0 uM and 1000 uM as the testing conditions. We shall, for now, not take Hill’s dynamics into account, and focus solely on the two concentration endpoints that best showcase the promoters’ two characteristics. We also calculated the fold-change (or fold-induction), defined as the ratio of maximal expression to leakiness: | ||
Line 172: | Line 172: | ||
[[File:TimeFI.pdf|850px|thumb|center| | [[File:TimeFI.pdf|850px|thumb|center| | ||
<center>''' Figure 5: Time-dependent FI measurement of all PB constructs at 0uM and 1000uM arabinose concentrations.'''</center>]] | <center>''' Figure 5: Time-dependent FI measurement of all PB constructs at 0uM and 1000uM arabinose concentrations.'''</center>]] | ||
+ | |||
[[File:TimeOD600.png|850px|thumb|center| | [[File:TimeOD600.png|850px|thumb|center| | ||
<center>''' Figure 6: Time-dependent OD600 measurement showing cell growth of transformed Marionettes at 0uM and 1000uM arabinose concentrations.'''</center>]] | <center>''' Figure 6: Time-dependent OD600 measurement showing cell growth of transformed Marionettes at 0uM and 1000uM arabinose concentrations.'''</center>]] | ||
+ | |||
[[File:Foldchange.png|850px|thumb|center| | [[File:Foldchange.png|850px|thumb|center| | ||
− | <center>''' Figure 7: Performances (leakiness, maximal expression and fold-change) of Marionettes with different PB constructs, measured by fluorescence intensity (a.u.). The scale of the circles indicates the degree of fold-change.'''</center>]] | + | <center>''' Figure 7: Performances (leakiness, maximal expression and fold-change) of Marionettes with different PB constructs, measured by fluorescence intensity (a.u.). The scale of the circles indicates the degree of fold-change. x-axis is leakiness, y-axis is max. expression.'''</center>]] |
+ | |||
+ | ==== Hill's induction assay ==== | ||
+ | We also hoped to characterise classical parameters of inducible systems, namely, the dissociation constant K<sub>D</sub> and the Hill’s coefficient n. Therefore, we carried out a combinatorial induction assay with arabinose concentrations ranging from 0, 10, 25, 50, 75, 100, 125, 200, 500, 1000 and 2000 uM. For this testing, we used a 384-well plate instead to test all constructs; and a robot called Opentron OT-2 to automate plate preparation. Results are shown below. | ||
+ | |||
+ | [[File:TimeFI_Hills.png|850px|thumb|center| | ||
+ | <center>''' Figure 8: Time-dependent FI measurement showing cell growth of transformed Marionettes under varying arabinose concentrations.'''</center>]] | ||
+ | |||
+ | [[File:TimeOD600_Hills.png|850px|thumb|center| | ||
+ | <center>''' Figure 15: Time-dependent OD600 measurement showing cell growth of transformed Marionettes under varying arabinose concentrations.'''</center>]] |
Revision as of 01:15, 12 October 2022
pBAD_AP
pBAD | |
---|---|
Function | Inducible promoter |
Chassis Tested | Escherichia coli (bacterial) |
Assembly Used | JUMP Assembly |
Abstraction Hierarchy | Part |
Related Device | BBa_K2442101 |
Backbone | pSC101 |
Submitted by | Cambridge iGEM 2022 |
This gene encodes an improved version of the wild-type araBAD promoter (nicknamed pBAD), an inducible promoter controlled by araC protein. The native pBAD is part of the araBAD operon, which is responsible for regulating arabinose metabolism in E.coli.
Contents
Usage and Biology
The exact definition of the araBAD promoter varies ambiguously between sources. Historically, pBAD only refers to a short segment upstream of the +1 transcription start site (referred to as the core promoter), containing the -35 and -10 boxes. However, as a complete promoter Part, the regulatory region further upstream is also included. In the following discussion, our definition of pBAD refers to the whole sequence consisting of both the regulatory sequence and the core promoter.
The araBAD promoter regulates the araBAD operon and is controlled by araC - a regulatory protein known for its “love-hate” mechanism of action. The upstream regulatory region consists of various protein binding sites - araI1, araI2, araO1 and araO2 can be occupied by araC. Between araI1 and araO1 also lies a CAP binding site, which recruits Catabolite receptor protein for transcription activation. The spacing between araO1 and O2 is noticeably large, reaching nearly 210 bp, which, unsurprisingly, is responsible for the overall bulkiness of the promoter. Interestingly, a region within this spacer contains a promoter of araC gene, which runs in the opposite direction to the araBAD operon. This promoter is regulated by araO1 just downstream. The araC protein therefore not only regulates the araBAD operon but also controls its own production by binding to araO1 region (negative autoregulation).
In the absence of L-arabinose, transcription is repressed by the action of two araC molecules binding to the structure. One araC binds to araI1 and the other binds to araO2 further upstream. The dimerization domain confers high affinity, bringing the two protein molecules closer to dimerize, essentially creating a DNA loop as a result. This looping mechanism prevents any sigma factors, RNA Polymerase or CRP from being recruited, thus repressing transcription.
In the presence of L-arabinose, binding of the sugar molecule to the arabinose-binding domain triggers a conformational change in the DNA-binding domain of araC, which reduces its affinity to distal araO2 site. This makes the protein more favourable to bind to araI2, just downstream of araI1. Therefore, the dimerized complex is formed at araI1-araI2 site instead of araO2-araI1, which breaks the loop and hence activates transcription. The dimer araC also “nudges” the RNA Polymerase for enhanced transcription.
pBAD Entries in the Registry
Our team essentially created a family of combinatorial pBADs, some of which yielded significant improvement from the wild-type version. We list below several previous entries of the araBAD promoters, some of which may offer stronger merits in certain aspects. All of our designs have a truncated length of less than 160 base pairs, which is only half of the typical size.
- BBa_K2442101 by team Glasgow 2017
- PBAD_SPL by team Denmark DTU 2013.
- PBAD_Promoter_Family by team British Columbia 2009.
Preamble from the Cambridge team
The Cambridge 2022 Team had intended to use the araBAD promoter to build an antithetic feedback circuit that demonstrates robust perfect adaptation (RPA). However, we were concerned that wild-type PBAD is relatively large, topping at around 300 bp, which increases the bulkiness of our Level-2 construct and reduces efficiency. Also, pBAD, by nature, is a relatively leaky and medium-strength promoter, therefore, lots of araC is needed to fully reach maximal activation. However, overexpression of araC is toxic to cells, and thus can drastically impede performance of the circuit. we therefore thought it would be an interesting Part Improvement project to redesign the existing wild-type promoter. Our initial goal was to engineer a PBAD with minimal length, but shows both lower leakiness and higher maximal activity. To achieve this, we did intensive literature search for prior optimization strategies. To understand the rationales, we also gathered information on the regulatory mechanism of the promoter, which was presumably only prevalent in papers from the 1970s.
We envisioned that the significant reduction in the promoter’s size can be of frugal advantage for future circuit designs. With less than 150 bp, the promoter can be synthesised by oligo-annealing, which is significantly faster and cheaper than ordering DNA parts. This could also be of great benefit for future iGEM teams from regions where DNA synthesis and delivery are often slow, allowing them to speed up project timelines.
pBAD_AP sequences
The table below shows nine newly-designed araBAD promoters, all with less than 160 base pairs. To see our design rationales for all sequences, please check out the Design page.
Identifiera | Rationale 1b | Rationale 2 | Rationale 3 | Part sequences | |
---|---|---|---|---|---|
AP1 | + | - | - | agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta
cctgacgctttttatcgcaactctctactgtttctccatacccg | |
AP2 | + | + | - | agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
cctgacgctttttatcgcaactctctactgtttctccatacccg | |
AP3 | + | - | + | agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggat
cctacctgacgctttttatcgcaactctctactgtttctccatacccg | |
AP4 | + | + | + | agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg | |
AP5 | + | + (78)c | + | agaaaccaattgtccatattgcatcagacattgccgtcacattgattatttgcacggcgtcacactttgctatgccatagcaagatagt
ccataagattagcgtttttatcctgacgtgcgcctgccgtccaaagtaatatccttacatacccg | |
AP6 | - | + | - | acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
cctgacgctttttatcgcaactctctactgtttctccatacccg | |
AP7 | - | + | + | acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcgtttttat
cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg | |
AP8 | - | - | + | acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta
cctgacgtgcgcctgccgtccaaagtaatatccttacatacccg | |
AP9 | - | - | - | agaaaccaattgtccataattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatccta
cctgacgctttttatcgcaactctctactgtttctccatacccg |
a AP refers to the initials of the principal designer of the araBAD promoters.
b(-) in Rationale 1 refers to complete removal of both araO2 and the spacing, but still leaves the CAP binding site.
c AP5 has a spacing of 78 bp instead of the common 56 bp.
Experimental design
To test the designed araBAD promoters, we cloned nine respective Level 0 promoter parts into Level 1 JUMP constructs [], using a standard Golden Gate Assembly protocol with BsaI-HFv2. Lying downstream of the promoter is a B0032 medium RBS, an mVenus reporter and a DT5 double terminator. A medium-strength RBS was chosen to avoid burden caused by accidental overexpression of mVenus. All TUs were put into a pJUMP27-1A destination vector. The low copy number plasmid makes it favourable for avoiding phototoxicity and aggregate bodies, as well as reducing noise. A list of constructs ID and their respective constituent promoter is given below.
Golden-gate-assembled mixtures were chemically transformed into DH5alpha cells for selection on Kanamycin plates. cPCR was carried out on seemingly-good colonies to screen for bands with correct size. Colonies with successful assemblies, indicated by cPCR, were liquid cultured for next-day miniprep. The retrieved plasmids, once verified through Sanger sequencing, were then transformed into a Marionette-Wild strain by electroporation. We chose Marionette as the testing strain because it is highly optimised as an arabinose sensor. Colonies of Marionette cells (selected on Kanamycin plates) were inoculated in 2 mL Neidhardt EZ Rich Defined Medium (EZRDM) and shaking-incubated overnight for 20 hours, at 37oC and 250 rpm.
We conducted two experiments to validate the nine pBADs against the wild-type counterpart and a negative control. The negative control (termed PBneg) was a dummy construct with similar length, containing mVenus CDS, but no araBAD promoters. Both the wild-type (PB10) and the PBneg constructs were cloned using the method described above.
Both experiments would involve measuring mVenus fluorescence intensity (FI) of transformed Marionettes grown under varying arabinose concentrations. FI was measured using a ClarioStar plate reader, on Greiner F-bottom 96-well plates or standard Greiner 384-well plates.
Results
Two-Level factorial screen
We first investigated the leakiness and maximal strength of the eight P_BADs. We chose arabinose concentrations of 0 uM and 1000 uM as the testing conditions. We shall, for now, not take Hill’s dynamics into account, and focus solely on the two concentration endpoints that best showcase the promoters’ two characteristics. We also calculated the fold-change (or fold-induction), defined as the ratio of maximal expression to leakiness:
Fold change = Max expression / Leakiness
Each sample was done in four replicates. The raw data are plotted in Figure 5,6 and 7.
Hill's induction assay
We also hoped to characterise classical parameters of inducible systems, namely, the dissociation constant KD and the Hill’s coefficient n. Therefore, we carried out a combinatorial induction assay with arabinose concentrations ranging from 0, 10, 25, 50, 75, 100, 125, 200, 500, 1000 and 2000 uM. For this testing, we used a 384-well plate instead to test all constructs; and a robot called Opentron OT-2 to automate plate preparation. Results are shown below.