Difference between revisions of "Part:BBa K4197007"
Laurelamothe (Talk | contribs) |
Laurelamothe (Talk | contribs) |
||
Line 1: | Line 1: | ||
__NOTOC__ | __NOTOC__ | ||
− | <partinfo> | + | <partinfo>BBa_K4197007 short</partinfo> |
OmpA_ana o 3 fusion to display cashew allergen. | OmpA_ana o 3 fusion to display cashew allergen. |
Revision as of 23:20, 8 October 2022
OmpA_Ana o 3 fusion
OmpA_ana o 3 fusion to display cashew allergen.
Introduction
This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ana o 3 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).
Construction
Ana o 3 gene ordered on IDT (shown above in Figure 12) was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was 479 bp.
Amplification product sizes were checked on EtBr stained agarose gel (Figure 13).
The products matched expected sizes and amplicons were further purified from the gel. The Ana o 3 construction was inserted into pET-21 b (+)_OmpA linearized (see Figure 6) by In-Fusion.
In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 14).
These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments: 5052 bp and 3211 pb) to assess the assembly (Figure 15).
The correct restriction maps were observed and these clones were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Ana o 3.
The plasmid was finally used to transform E. coli Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.
Achievements so far: we managed to have all our allergen construction correctly cloned.
Validation
The plasmid was eventually used to transform E. coli Tuner cells in order to express the OmpA_Ana o 3 construction at the cell membrane. The expression and display controls should have been conducted using anti-Ana o 3 antibodies to check wether the allergen displayed on the bacteria were able to link to their specific IgE. However, due to the high price of these IgE, the experiment was not performed.
References
More information about the project for which the part was created: DAISY (INSA-UPS 2022)
Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Der p 2
- OmpA_Gal d 2
- Van der Valk, J. P. M., J. Dubois, A. E., Gerth van Wijk, R., Wichers, H. J., de Jong, N. W. (2014). Systematic review on cashew nut allergy. Allergy. 69(6), 692–698. doi:10.1111/all.12401
- Sato, S., Movérare, R., Ohya, Y., Ito, K., Nagao, M., Borres, M. P., & Ebisawa, M. (2019). Ana o 3–specific IgE is a predictive marker for cashew oral food challenge failure. The Journal of Allergy and Clinical Immunology : In Practice, 7(8), 2909–2911.e4. https://doi.org/10.1016/j.jaip.2019.04.049
- Robotham, J. M., Wang, F., Seamon, V., Teuber, S. S., Sathe, S. K., Sampson, H. A., Beyer, K., Seavy, M., & Roux, K. H. (2005). Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. Journal of Allergy and Clinical Immunology, 115(6), 1284–1290.
- Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
- Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2368