Difference between revisions of "Part:BBa K4197021"
Line 30: | Line 30: | ||
<a href="https://static.igem.wiki/teams/4197/wiki/results/facs/fig-56-mscarlet-petri.jpg" class="internal" title="Enlarge"></a> | <a href="https://static.igem.wiki/teams/4197/wiki/results/facs/fig-56-mscarlet-petri.jpg" class="internal" title="Enlarge"></a> | ||
</div> | </div> | ||
− | <b>Figure 2: </b>Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells | + | <b>Figure 2: </b><b>Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells. </b> |
The colonies were selected on LB-ampicillin plates. Pink coloring indicates the expression of the mScarlet-I. | The colonies were selected on LB-ampicillin plates. Pink coloring indicates the expression of the mScarlet-I. | ||
</div> | </div> |
Revision as of 18:57, 8 October 2022
Ana o 3 expression at the surface of E. coli cells sortable by FACS using mSCARLET-I
OmpA_Ana o 3 fusion + mSCARLET-I with ihfb800 promoter
Introduction
The part expressing the gene of cashew nut Ana o 3 (K4197007) has been completed with the ihfb800-mScarlet construction (K41970022) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.
Construction
The ihfb800-mScarlet construction was amplified by PCR with the high-fidelity Phusion polymerase using IF3_mSCARLET-I F (ttatttgtacagttcatccataccacc) and IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (K4197007) by In-Fusion.
The resulting products were transformed into Stellar cells and positive transformants were selected.
Validation
Successful colonies have shown bright pink fluorescence (Figure 1).
References
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2368