Difference between revisions of "Part:BBa K4197010"
Line 23: Line 23:
 
<a href="https://static.igem.wiki/teams/4197/wiki/results/construction-of-strain-d/dgfp-fragment.png" class="internal" title="Enlarge"></a>
 
<a href="https://static.igem.wiki/teams/4197/wiki/results/construction-of-strain-d/dgfp-fragment.png" class="internal" title="Enlarge"></a>
 
</div>
 
</div>
−
<b>Figure 1: </b> <b>Figure 18: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp.</b>
+
<b>Figure 1: </b> <b>OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp.</b>
 
<i>The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).</i>
 
<i>The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).</i>
  

Revision as of 18:18, 8 October 2022


_NOTOC__ OmpA_DARPin_sfGFP fusion

Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.

Introduction

This part is composed of the gene coding for the DARPin E2_79 protein. This synthetic protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was linked to a sfGFP protein. This was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in yhe membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). The fusion protein is described in Part: BBa_K4197011. The sfGFP will be used as a reporter to prove that the fusion protein is expressed at the surface of the membrane. h

Construction

The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part). OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp (Figure 1).

Figure 1: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).
The DARPin-sfGFP construction was then inserted into our linearized pET-21 b (+) by In-Fusion to assemble the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid. The In-Fusion mixture was first transformed into chemically competent E. coli Stellar cells. Transformants were selected on LB-ampicillin plates. Resulting colonies were checked by a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of positive colonies was 1885 bp (Figure 2) Plasmids colonies containing the isert were extracted by Miniprep.42
Figure 2: identifying strains that bear pET-21 b (+)_Ompa_DARPin-sfGFP by colony PCR. The expected size of the amplicon was 1885 bp. The positive clones were colonies 13, 14, 15 and 16. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gels (note that a different ladder is presented on the theoretical gel).

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

  • Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
  • Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

  • CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
  • Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

  1. Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
  2. Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
  3. Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
    4.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 130
    Illegal NheI site found at 92
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 130
    Illegal BamHI site found at 124
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
    Illegal AgeI site found at 832
  • 1000
    COMPATIBLE WITH RFC[1000]