Difference between revisions of "Part:BBa K4197010"
Line 13: | Line 13: | ||
<p>The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part). | <p>The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part). | ||
− | OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp.</p> | + | OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp (Figure 1).</p> |
<div class="center"> | <div class="center"> | ||
Line 24: | Line 24: | ||
</div> | </div> | ||
<b>Figure 1: </b> <b>Figure 18: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp.</b> | <b>Figure 1: </b> <b>Figure 18: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp.</b> | ||
− | The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel). | + | <i>The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).</i> |
</div> | </div> | ||
Line 30: | Line 30: | ||
</div> | </div> | ||
</div> | </div> | ||
+ | The DARPin-sfGFP construction was then inserted into our linearized pET-21 b (+) by In-Fusion to assemble the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid. | ||
+ | |||
+ | The In-Fusion mixture was first transformed into chemically competent <i>E. coli</i> Stellar cells. Transformants were selected on LB-ampicillin plates. Resulting colonies were checked by a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of positive colonies was 1885 bp (Figure 2) | ||
+ | Plasmids colonies containing the isert were extracted by Miniprep.42 | ||
+ | |||
+ | |||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:50%;"> | ||
+ | <a href="https://static.igem.wiki/teams/4197/wiki/results/construction-of-strain-d/dgfp-screening.png"> | ||
+ | <img alt="" src="https://static.igem.wiki/teams/4197/wiki/results/construction-of-strain-d/dgfp-screening.png" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="https://static.igem.wiki/teams/4197/wiki/results/construction-of-strain-d/dgfp-screening.png" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 2: </b> <b> | ||
+ | identifying strains that bear pET-21 b (+)_Ompa_DARPin-sfGFP by colony PCR. The expected size of the amplicon was 1885 bp. </b> | ||
+ | <i> The positive clones were colonies 13, 14, 15 and 16. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gels (note that a different ladder is presented on the theoretical gel).</i> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
<h2>Xxxxxxxxx</h2> | <h2>Xxxxxxxxx</h2> | ||
<p>Xxxxxxxxxxxxx</p> | <p>Xxxxxxxxxxxxx</p> |
Revision as of 18:17, 8 October 2022
_NOTOC__
OmpA_DARPin_sfGFP fusion
Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.
Introduction
This part is composed of the gene coding for the DARPin E2_79 protein. This synthetic protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was linked to a sfGFP protein. This was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in yhe membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). The fusion protein is described in Part: BBa_K4197011. The sfGFP will be used as a reporter to prove that the fusion protein is expressed at the surface of the membrane. h
Construction
The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part). OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp (Figure 1).
The DARPin-sfGFP construction was then inserted into our linearized pET-21 b (+) by In-Fusion to assemble the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid. The In-Fusion mixture was first transformed into chemically competent E. coli Stellar cells. Transformants were selected on LB-ampicillin plates. Resulting colonies were checked by a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of positive colonies was 1885 bp (Figure 2) Plasmids colonies containing the isert were extracted by Miniprep.42Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
- Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
- Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG
Xxxxxxxxxx
- CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
- Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
- Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
- Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
- Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 130
Illegal NheI site found at 92 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 130
Illegal BamHI site found at 124 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 130
Illegal XbaI site found at 47
Illegal AgeI site found at 832 - 1000COMPATIBLE WITH RFC[1000]