Difference between revisions of "Part:BBa K4197022"
Line 3: Line 3:
 
<partinfo>BBa_K4197022 short</partinfo>
 
<partinfo>BBa_K4197022 short</partinfo>
  
−
Gene coding for mSCARLET-I with ihfB800 promoter
+
Red fuorescent protein mScarlet-I expressed with a constitutive promoter of <i>E. coli</i>.
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the mScarlet-I (<a href="https://parts.igem.org/Part:BBa_K2333414">BBa_K2333414</a>), a red fluorescent protein. It also contains the gene coding for the 800 first bp of the ihfB promoter, which was used to express mScarlet-I. This promoter has been identified as a constitutive <i>E. coli</i> promoter (Weglenska et al., 1996). It is often used by researchers of the Toulouse Biotechnology Institute to express recombinant fluorescent proteins in <i>E. coli</i> (Barthe et al., 2020), as it is strong enough to allow correct expression and weak enough to avoid inclusion bodies.</p>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
 
−
   
 
  
−
<div class="center">
+
<p>The objective of the INSA-UPS 2022 team was to use ihfB800 promoter to express mScarlet-I  into <i>E. coli</i> Tuner (DE3) cells.  
−
        <div class="thumb tnone">
+
  The functionality of the promoter and protein were confirmed as the mScarlet was successfully expressed (see <a href="https://parts.igem.org/Part:BBa_K4197020">BBa_K4197020</a> and <a href="https://parts.igem.org/Part:BBa_K4197021">BBa_K4197021</a>).
−
            <div class="thumbinner" style="width:50%;">
+
   
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
+
<h2>References</h2>
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                 <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 1: </b> <b>Xxxxxx</b>  
+
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<h2>Xxxxxxxxx</h2>
+
−
<p>Xxxxxxxxxxxxx</p>
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
+
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                 <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b>  
+
−
                Xxxxxxxxxxxxx.
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
</div>
+
−
   
+
−
<h2>titre 2</h2>
+
−
<h3>Titre 3</h3>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
  
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
  
−
<h3>titre 3</h3>
+
<p>Other parts of fluorescent proteins with ihfB800:<br>
−
    <h4>Titre 4</h4>
+
−
<p>Xxxxxx</p>
+
  
−
                 
+
- <a href="https://parts.igem.org/Part:BBa_K4197012">mRFP1</a><br>
−
<h4>Titre 4</h4>
+
- <a href="https://parts.igem.org/Part:BBa_K4197013">mTagBFP</a><br>
−
<p>xxxxxxx</p>
+
</p>
  
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
−
<h2>References</h2>
 
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4</li>
−
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20</i>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
−
</i>
+
 
</ol>
 
</ol>
 
</html>
 
</html>

Revision as of 16:56, 8 October 2022


mSCARLET-I under control of ihfB800 promoter

Red fuorescent protein mScarlet-I expressed with a constitutive promoter of E. coli.

Introduction

This part is composed of the gene coding for the mScarlet-I (BBa_K2333414), a red fluorescent protein. It also contains the gene coding for the 800 first bp of the ihfB promoter, which was used to express mScarlet-I. This promoter has been identified as a constitutive E. coli promoter (Weglenska et al., 1996). It is often used by researchers of the Toulouse Biotechnology Institute to express recombinant fluorescent proteins in E. coli (Barthe et al., 2020), as it is strong enough to allow correct expression and weak enough to avoid inclusion bodies.

Construction

The objective of the INSA-UPS 2022 team was to use ihfB800 promoter to express mScarlet-I into E. coli Tuner (DE3) cells. The functionality of the promoter and protein were confirmed as the mScarlet was successfully expressed (see BBa_K4197020 and BBa_K4197021).

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts of fluorescent proteins with ihfB800:
- mRFP1
- mTagBFP

  1. Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
  2. Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1520
    Illegal XbaI site found at 1505
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1520
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1512
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1520
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1520
    Illegal XbaI site found at 1505
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1520
    Illegal XbaI site found at 1505
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1475
  • 1000
    COMPATIBLE WITH RFC[1000]