Difference between revisions of "Part:BBa K4197020"

Revision as of 22:12, 8 October 2022

Ara h 2 expression at the surface of E. coli cells sortable by FACS using mSCARLET-I

OmpA_Ara h 2 fusion + mSCARLET-I with ihfb800 promoter

Introduction

The part expressing the gene of arachid Ara h 2 (K4197008) has been completed with the ihfb800-mScarlet construction (K4197022) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.

Construction

The ihfb800-mScarlet construction was amplified by PCR with the high-fidelity Phusion polymerase using IF3_mSCARLET-I F (ttatttgtacagttcatccataccacc) and IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ara h 2 (K4197008) by In-Fusion.

The resulting products were transformed into Stellar cells and positive transformants were selected.

Validation

Successful colonies have shown bright pink fluorescence (Figure 1).

Figure 2: Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells. The colonies were selected on LB-ampicillin plates. Pink coloring indicates the expression of the mScarlet-I.

References

1. K4197008
2. K4197022
3. DAISY (INSA-UPS 2022)

Sequence and Features