|
|
| Line 11: |
Line 11: |
| | <h2>Construction</h2> | | <h2>Construction</h2> |
| | <p>The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lippoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197009 »>BBa_K1694009</a>).</p> | | <p>The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lippoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197009 »>BBa_K1694009</a>).</p> |
| − | <p>OmpA_Gal d 2 fragment from IDT gblock was amplified by PCR using the high fidelity Phusion polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg) and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. Expected size of the amplicon was 1675 bp.</p>
| |
| − |
| |
| − | <p>pET-21 b (+) vector was linearized by PCR using the high fidelity Phusion polymerase with primers FORWARD:tgtcgacggagctcgaattcg and REVERSE:ttaaagcttgcggccgcactcg. Expected size of the amplicon was 5442 bp.</p>
| |
| − |
| |
| − | <p>Amplification product sizes were checked on EtBr stained agarose gel (Figure 1).</p>
| |
| − |
| |
| − |
| |
| − | <figure class="normal mx-auto">
| |
| − | <img
| |
| − | class="d-block"
| |
| − | src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/pet-21-b-linearized-and-gal-d-2-fragment.png" title= "Figure 1: pet lin and gal fragment" alt="Figure 2: pet lin and gal fragment"
| |
| − | <figcaption class="normal"><span class="titre-image"><i><b>Figure 1: pET-21 b (+) linearized (A) and Gal d 2 amplified fragment (B). Expected sizes of the amplicons were 5442 bp (A) and 1675 bp (B).</b> PCR amplicon sizes of pET-21 b (+) (A) and Gal d 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels. (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
| |
| − | </figure>
| |
| − |
| |
| − | <p>Amplification products matched the expected size, they were further purified from gel.</p>
| |
| − |
| |
| − | <p>The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone (FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc, expected size of the amplicon : 2092 bp). 2 positive transformants were detected (Figure 3).</p>
| |
| − |
| |
| − | <figure class="normal mx-auto" style="width: 40vw;height: auto">
| |
| − | <img
| |
| − | class="d-block"
| |
| − | src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/gal-d-2-screening.png" title= "Figure 2: gal screening" alt="Figure 2: gal screening" class="img-fluid"
| |
| − | <figcaption class="normal"><span class="titre-image"><i><b>Figure 2: identifying fragments that bear pET21 b (+)_Ompa_Gal d 2 by colony PCR. Expected size of the amplicon was 2092 bp. The positive clones were colonies 17 and 24.</b> PCR amplicon sizes of colonies with Gal d 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
| |
| − | </figure>
| |
| − |
| |
| − | <p>These transformants had their plasmid extracted by Miniprep and digested by EcoRV to assess the assembly (expected fragments at 4332 bp and 2785 bp, see Figure 4).</p>
| |
| − |
| |
| − | <figure class="normal mx-auto" style="width: 40vw;height: auto">
| |
| − | <img
| |
| − | class="d-block w-100"
| |
| − | src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/gal-d-2-digestion.png" title= "Figure 3: gal digestion" alt="Figure 3: gal digestion" class="img-fluid"
| |
| − | <figcaption class="normal"><span class="titre-image"><i><b>Figure 3: restriction profile of pET-21 b (+)_OmpA_Gal d 2 final construction. Enzyme used was EcoRV. Expected sizes of the amplicons were 4332 bp and 2785 bp.</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
| |
| − | </figure>
| |
| − |
| |
| − | <p>The correct restriction maps were obtained and the insert sequence was further validated by sequencing. The plasmid was named <b>pET-21 b (+)_OmpA_Gal d 2</b>. The plasmids were eventually used to transform <i>E. coli</i> Tuner cells in order to express the OmpA_Gal d 2 construction at the cell membrane. But no proof was obtain of the expression. </p>
| |
| | | | |
| | | | |
| Line 54: |
Line 19: |
| | <li>Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954</li> | | <li>Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954</li> |
| | | | |
| − |
| |
| − | <li>Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009</li>
| |
| − |
| |
| − | <li>Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001</li>
| |
| | </ol> | | </ol> |
| | </html> | | </html> |
Gene coding for the egg allergen called Gal d 2.
This part is composed of the gene coding for the allergen of Hen’s egg Gal d 2 (NCBI: V00383.1). The Hen's egg allergy prevalence is 0,5-2,5% in developped countries and Gal d 2 compose 54% of its dry mass (Palosuo and al. 2018). Gal d 2 have already been expressed in Express Iq E. coli and was able to bind the IgE of patient with egg's allergie (Dhanapala and al. 2015).
The objective of the INSA-UPS 2022 team was to display Gal d 2 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lippoprotein (see part Sequence and Features
