Difference between revisions of "Part:BBa K4247024:Design"

(→‎Design Notes)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon, which enables to perform PTMs in vivo to the tyrosines of the host. To do so, we placed orf438 after a common E.coli RBS a(TTTGTTTAACTTTAAGAAGGAGA) followed by TATACAT and a small sequence before the 6-His Tag of Orf438 (ATGCGGGGTTCT). After the 6His Tag we placed a glycine and then the original Orf438 sequence.
+
We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon. The products of this operon enables the host to perform PTMs on the tyrosine residues in vivo. To do so, we placed orf438 after a common E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA), followed by TATACAT, a small sequence and then, a 6-His Tag (ATGCGGGGTTCT). After the 6-His Tag, we placed a glycine residue, followed by the original Orf438 coding sequence.  
−
Since in the organism S. antibioticus the orf438 and tyrosinase are placed in an operon, we decided to place a spacer AAGCACTAATAAT, and then repeat the E.coli RBS TTTGTTTAACTTTAAGAAGGAGA. After few base pairs TTATCTG, the tyrosinase sequence begins and ends with another 6-His Tag. You can see the plasmid construction in the image below. In our system we placed first the orf438 and then the tyrosinase sequence, to simulate better the results found by Barnan et al., 1985; however, Choi et al., 2012 placed the orf438 after the tyrosinase gene.
+
  
 +
Since in the organism S. antibioticus, the orf438 and tyrosinase are placed in an operon, we decided to place a spacer (AAGCACTAATAAT) after the end of the orf438 coding sequence, and then repeat the E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA). After few a small sequence (TTATCTG), the tyrosinase coding sequence begins. The tyrosinase coding sequence is followed by another 6-His Tag. The plasmid construction can be seen in the image below.
 +
 +
In our system we placed first the orf438 and then the tyrosinase sequence, to better simulate the results found by Barnan et al., 1985. However, Choi et al., 2012 placed the orf438 after the tyrosinase gene.
 +
 +
The protein we were co-expressing, mfp151, was placed in pET24(+) and we therefore, used pRSETa plasmid for expressing the orf438-tyrosinase operon so that the 2 plasmids have different ori and selection markers - Kan for pET24(+) and Amp for pRSETa. The plasmids were induced by using 0.1-0.2 mM IPTG.
  
 
[[File:Oporf438.jpeg|px300|]]
 
[[File:Oporf438.jpeg|px300|]]

Revision as of 13:39, 30 September 2022


orf438-tyrosinase operon


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 37
    Illegal NotI site found at 76
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 896
    Illegal AgeI site found at 798
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1138


Design Notes

We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon. The products of this operon enables the host to perform PTMs on the tyrosine residues in vivo. To do so, we placed orf438 after a common E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA), followed by TATACAT, a small sequence and then, a 6-His Tag (ATGCGGGGTTCT). After the 6-His Tag, we placed a glycine residue, followed by the original Orf438 coding sequence.

Since in the organism S. antibioticus, the orf438 and tyrosinase are placed in an operon, we decided to place a spacer (AAGCACTAATAAT) after the end of the orf438 coding sequence, and then repeat the E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA). After few a small sequence (TTATCTG), the tyrosinase coding sequence begins. The tyrosinase coding sequence is followed by another 6-His Tag. The plasmid construction can be seen in the image below.

In our system we placed first the orf438 and then the tyrosinase sequence, to better simulate the results found by Barnan et al., 1985. However, Choi et al., 2012 placed the orf438 after the tyrosinase gene.

The protein we were co-expressing, mfp151, was placed in pET24(+) and we therefore, used pRSETa plasmid for expressing the orf438-tyrosinase operon so that the 2 plasmids have different ori and selection markers - Kan for pET24(+) and Amp for pRSETa. The plasmids were induced by using 0.1-0.2 mM IPTG.

Oporf438.jpeg

Source

NCBI accession: WP_030787646.1 Tyrosinase NCBI accession: WP_078632176 Orf438 (tyrosinase cofactor)


References

Choi et al.:In vivo modification of tyrosine residues in recombinant mussel adhesive protein by tyrosinase co-expression in Escherichia coli. Microbial Cell Factories, 2012 11:139.

Bernan V, Filpula D, Herber W, Bibb M, Katz E. The nucleotide sequence of the tyrosinase gene from Streptomyces antibioticus and characterization of the gene product. Gene. 1985;37(1-3):101-10. doi: 10.1016/0378-1119(85)90262-8. PMID: 3932128.