Difference between revisions of "Part:BBa K4247024:Design"

Revision as of 17:29, 29 September 2022

orf438-tyrosinase operon

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
INCOMPATIBLE WITH RFC[12]
Illegal NheI site found at 37
Illegal NotI site found at 76
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
INCOMPATIBLE WITH RFC[25]
Illegal NgoMIV site found at 896
Illegal AgeI site found at 798
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI site found at 1138

Design Notes

We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon, which enables to perform PTMs in vivo to the tyrosines of the host. To do so, we placed orf438 after a common E.coli RBS a(TTTGTTTAACTTTAAGAAGGAGA) followed by TATACAT and a small sequence before the 6-His Tag of Orf438 (ATGCGGGGTTCT). After the 6His Tag we placed a glycine and then the original Orf438 sequence. Since in the organism S. antibioticus the orf438 and tyrosinase are placed in an operon, we decided to place a spacer AAGCACTAATAAT, and then repeat the E.coli RBS TTTGTTTAACTTTAAGAAGGAGA. After few base pairs TTATCTG, the tyrosinase sequence begins and ends with another 6-His Tag. You can see the plasmid construction in the image below. In our system we placed first the orf438 and then the tyrosinase sequence, to simulate better the results found by Barnan et al., 1985; however, Choi et al., 2012 placed the orf438 after the tyrosinase gene.

Source

NCBI accession: WP_030787646.1 Tyrosinase NCBI accession: WP_078632176 Orf438 (tyrosinase cofactor)

References

Choi et al.:In vivo modification of tyrosine residues in recombinant mussel adhesive protein by tyrosinase co-expression in Escherichia coli. Microbial Cell Factories, 2012 11:139.

Bernan V, Filpula D, Herber W, Bibb M, Katz E. The nucleotide sequence of the tyrosinase gene from Streptomyces antibioticus and characterization of the gene product. Gene. 1985;37(1-3):101-10. doi: 10.1016/0378-1119(85)90262-8. PMID: 3932128.

@@ Line 7: / Line 7: @@
 ===Design Notes===
-The enzyme tyrosinase is an oxidase found across taxa, it contains copper and is well known for its tyrosine modifying step that gives melanin. Our project specifically focused on converting the tyrosines of mfp151 (parts BBa_K4247020, BBa_K4247021) into DOPA in E.coli, a post-translational modification that makes mfp sticky. A way to achieve this dopaquinone conversion is by first producing mfp in vitro and then expose it to tyrosinase, but it has the limitations of having to purify the enzymes and of not allowing the dopa modification to occur in all the tyrosines that are not exposed to the enzyme. For this reason, we focused on a co-expression system where E.coli would have mfp151 on a plasmid and tyrosinase with its copper cofactor (orf438) on another. By inducing with IPTG, the tyrosines incorporated in the mfp151 protein have been hydroxylated to DOPA.
+We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon, which enables to perform PTMs in vivo to the tyrosines of the host. To do so, we placed orf438 after a common E.coli RBS a(TTTGTTTAACTTTAAGAAGGAGA) followed by TATACAT and a small sequence before the 6-His Tag of Orf438 (ATGCGGGGTTCT). After the 6His Tag we placed a glycine and then the original Orf438 sequence.
+Since in the organism S. antibioticus the orf438 and tyrosinase are placed in an operon, we decided to place a spacer AAGCACTAATAAT, and then repeat the E.coli RBS TTTGTTTAACTTTAAGAAGGAGA. After few base pairs TTATCTG, the tyrosinase sequence begins and ends with another 6-His Tag. You can see the plasmid construction in the image below. In our system we placed first the orf438 and then the tyrosinase sequence, to simulate better the results found by Barnan et al., 1985; however, Choi et al., 2012 placed the orf438 after the tyrosinase gene.
 [[File:Oporf438.jpeg|px300|]]