Difference between revisions of "Part:BBa K4221010"

 
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4221010 short</partinfo>
 
<partinfo>BBa_K4221010 short</partinfo>
−
 
−
 
−
 
−
 
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
Line 18: Line 12:
 
<partinfo>BBa_K4221010 parameters</partinfo>
 
<partinfo>BBa_K4221010 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Usage===
 +
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
 +
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
 +
Using EBFP[2] as target proteincan visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
 +
 +
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
 +
 +
===Biology===
 +
Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria).
 +
Design Consideration:
 +
The construct was cloned into a PET28a plasmid and transformed into EBFP-PET28a [2]
 +
The construction includes:
 +
EBFP is fused with BslA with a TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）
 +
 +
===Protein Expression===
 +
 +
[[File:figure-2 a .png|500px]]<br>
 +
'''Figure 1.'''
 +
 +
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 +
 +
[[File:figure-2 b .png|500px]]<br>
 +
 +
'''Figure 1.'''
 +
 +
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
 +
 +
[[File:figure-3 a .png|500px]]<br>
 +
 +
'''Figure 2.'''
 +
 +
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 +
 +
[[File:figure-3 b .png|500px]]<br>
 +
 +
'''Figure 2.'''
 +
 +
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
 +
 +
===Detection of fusion protein function===
 +
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.
 +
 +
[[File:figure-8 .png|500px]]<br>
 +
'''Figure 3.'''Water contact angle.
 +
 +
===Aqueous two-phase separation (ATPS) Testing===
 +
We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.
 +
 +
[[File:figure-9 a .png|500px]]<br>
 +
'''Figure 4.''' ATPS testing.
 +
 +
===Reference===
 +
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
 +
 +
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
 +
 +
[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3).
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===

Revision as of 13:13, 10 October 2022


EBFP-TEVlinker-BslA(42-181aa)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using EBFP[2] as target proteincan visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.

Biology

Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria). Design Consideration: The construct was cloned into a PET28a plasmid and transformed into EBFP-PET28a [2] The construction includes: EBFP is fused with BslA with a TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）

Protein Expression

Figure-2 a .png
Figure 1.

(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-2 b .png

Figure 1.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-3 a .png

Figure 2.

(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-3 b .png

Figure 2.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.

Figure-8 .png
Figure 3.Water contact angle.

Aqueous two-phase separation (ATPS) Testing

We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.

Figure-9 a .png
Figure 4. ATPS testing.

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3).