Difference between revisions of "Part:BBa K4197003"
Line 4: | Line 4: | ||
Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS | Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS | ||
+ | |||
+ | <html> | ||
+ | |||
+ | <h2>Introduction</h2> | ||
+ | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | ||
+ | |||
+ | <h2>Construction</h2> | ||
+ | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | ||
+ | |||
+ | |||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:50%;"> | ||
+ | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image"> | ||
+ | <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 1: </b> <b>Xxxxxx</b> | ||
+ | Xxxxxxxxxxxxxxxxxxxxxxxxxxx. | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | <h2>Xxxxxxxxx</h2> | ||
+ | <p>Xxxxxxxxxxxxx</p> | ||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:80%;"> | ||
+ | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image"> | ||
+ | <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> | ||
+ | Xxxxxxxxxxxxx. | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <h2>titre 2</h2> | ||
+ | <h3>Titre 3</h3> | ||
+ | <p>Xxxxxxxxxx</p> | ||
+ | <ul> | ||
+ | <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li> | ||
+ | <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li> | ||
+ | </ul> | ||
+ | <p>Xxxxxxxxxx</p> | ||
+ | <ul> | ||
+ | <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li> | ||
+ | <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li> | ||
+ | </ul> | ||
+ | |||
+ | |||
+ | <h3>titre 3</h3> | ||
+ | <h4>Titre 4</h4> | ||
+ | <p>Xxxxxx</p> | ||
+ | |||
+ | |||
+ | <h4>Titre 4</h4> | ||
+ | <p>xxxxxxx</p> | ||
+ | |||
+ | <h2>Titre 2</h2> | ||
+ | <p>Xxxxxx</p> | ||
+ | <h2>References</h2> | ||
+ | <ol> | ||
+ | <i> | ||
+ | <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li> | ||
+ | <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li> | ||
+ | <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li> | ||
+ | </i> | ||
+ | </ol> | ||
+ | </html> | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Revision as of 09:50, 22 September 2022
Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1
Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS
Introduction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Construction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
- Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
- Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG
Xxxxxxxxxx
- CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
- Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
- Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
- Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
- Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2368