Difference between revisions of "Part:BBa K4197006"
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197006 short</partinfo>
 
<partinfo>BBa_K4197006 short</partinfo>
−
 
+
−
Brick expressing Der p 1 at the surface of <i>E. coli</i>.  
+
Gene fusion to express the dust mite allergen Der p 1 on the surface of <i>E. coli</i>.  
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the allergen of dust mite Der p 1 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/U11695.1/">U11695.1</a>). The mite allergy prevalence is 20% (lieberman and al. 2018) in the US and Der p 1, triggers 87% of the patients with dust mite allergy (Mueller and al. 2015). Ara h 2 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with peanut's allergie (lehmann and al. 2003). Ara h 2 was merged to the membrane protein OmpA of <i>E. coli </i> (<a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>), to display Ara h  on the surface of <i>E. coli </i>. This lippoprotein is the most abundant in <i>E. coli's </i>membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). </p>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
   
−
   
+
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<p>Der p 1 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Der p 1 (cctgtattttcagagcatgaaaatcgtgctggc). Expected size of the amplicon was  994 bp.</p>
 +
 
 +
<p>Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 9).</p>
 +
 
 +
<figure class="normal mx-auto" style="width: 40vw;height: auto">   
 +
                                            <img
 +
                                                                        class="d-block w-100"
 +
                                                                        src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/der-p-1-fragment.png" title= "Figure 9: der fragment" alt="Figure 9: der fragment" class="img-fluid"
 +
                                                                        <figcaption class="normal"><span class="titre-image"><i><b>Figure 9: Der p 1 amplified fragment. Expected size of the amplicons was 994 bp.</b> PCR amplicon sizes Der p 1 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
 +
                                        </figure>
 +
 
 +
<p>PCR products matched expected sizes and amplicons were further purified from the gel. The Der p 1 construction was inserted into linearized pET-21 b (+)_OmpA (see Figure 6) by In-Fusion.</p>
 +
 
 +
<p>The In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc; expected size of the amplicons: 1894 bp) (see <a href="https://2022.igem.wiki/toulouse-insa-ups/materials"><span class="gras orange">Primers List</span></a>). 12 positive transformants were detected (Figure 10).</p>
 +
 
 +
<figure class="normal mx-auto" style="width: 40vw;height: auto">   
 +
                                            <img
 +
                                                                        class="d-block w-100"
 +
                                                                        src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/der-p-1-screening.png" title= "Figure 10: der screening" alt="Figure 10: der screening" class="img-fluid"
 +
                                                                        <figcaption class="normal"><span class="titre-image"><i><b>Figure 10: identifying strains that bear pET21 b (+)_OmpA_Der p 1 by colony PCR. The expected size of the amplicons was 1894 bp. 12 positive clones were detected.</b> PCR amplicon sizes of colonies with Der p 1 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
 +
                                        </figure>
 +
 
 +
<p>Four of these transformants (colonies 2, 6, 11 and 13) had their plasmid extracted by Miniprep and digested by SalI (expected size of the fragments: 6 kb and 1 kb) or double-digested by HindIII and EcoRI-HF (expected size of the fragments: 5.5 kb and 1.5 kb) to assess the assembly (Figure 11).</p>
 +
 
 +
<figure class="normal mx-auto" style="width: 40vw;height: auto">   
 +
                                            <img
 +
                                                                        class="d-block w-100"
 +
                                                                        src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/der-p-1-digestion.png" title= "Figure 11: der digestion" alt="Figure 11: der digestion" class="img-fluid"
 +
                                                                        <figcaption class="normal"><span class="titre-image"><i><b>Figure 11: restriction profile of pET-21 b (+)_OmpA_Der p 1 for one of the clones. Enzymes were SalI for the simple digestion (expected sizes of the fragments were 6.0 kb and 1.0 kb) and EcoRI and HindIII for the double digestion (expected sizes of the fragments were 5.5 kb and 1.5 kb).</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i></span></figcaption>
 +
                                        </figure>
 +
 
 +
 
 +
<p>The correct restriction maps were obtained for the clones which were further validated by sequencing. The plasmid was named <b>pET-21 b (+)_OmpA_Der p 1</b>.</p>
 +
 
 +
<p>The plasmids were finally used to transform <i>E. coli</i> Tuner cells to express the Ompa_Der p 1 construction at the cell membrane.</p>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
  
 
<div class="center">
 
<div class="center">
Line 28: Line 95:
 
         </div>
 
         </div>
 
     </div>
 
     </div>
−
<h2>Xxxxxxxxx</h2>
 
−
<p>Xxxxxxxxxxxxx</p>
 
−
<div class="center">
 
−
    <div class="thumb tnone">
 
−
        <div class="thumbinner" style="width:80%;">
 
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
 
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                <div class="magnify">
 
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
 
−
                </div>
 
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
 
−
                Xxxxxxxxxxxxx.
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
</div>
 
−
   
 
−
<h2>titre 2</h2>
 
−
<h3>Titre 3</h3>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
  
  
−
<h3>titre 3</h3>
 
−
    <h4>Titre 4</h4>
 
−
<p>Xxxxxx</p>
 
  
−
                 
 
−
<h4>Titre 4</h4>
 
−
<p>xxxxxxx</p>
 
  
−
<h2>Titre 2</h2>
+
 
−
<p>Xxxxxx</p>
+
 
 +
 
 
<h2>References</h2>
 
<h2>References</h2>
 +
 +
 +
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
 +
 +
<p>Other parts to display allergens:<br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197007"> OmpA_Ana o 3</a> <br>
 +
    - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Fel d 4</a> <br>
 +
</p>
 +
 +
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
    <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
 
−
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
    <li>Mueller, G. A.; Randall, T. A.; Glesner, J.; Pedersen, L. C.; Perera, L.; Edwards, L. L.; DeRose, E. F.; Chapman, M. D.; London, R. E.; Pomés, A. (2016). Serological, genomic and structural analyses of the major mite allergen Der p 23. Clinical & Experimental Allergy, 46(2), 365–376. doi:10.1111/cea.12680 </li>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
 
 +
 
 +
     <li>Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009</li>
 +
 
 +
<li>Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001</li>
 
</i>
 
</i>
 
</ol>
 
</ol>

Revision as of 21:05, 6 October 2022


OmpA_Der p 1 Fusion

Gene fusion to express the dust mite allergen Der p 1 on the surface of E. coli.

Introduction

This part is composed of the gene coding for the allergen of dust mite Der p 1 (NCBI: U11695.1). The mite allergy prevalence is 20% (lieberman and al. 2018) in the US and Der p 1, triggers 87% of the patients with dust mite allergy (Mueller and al. 2015). Ara h 2 have already been expressed in E. coli and was able to bind the IgE of patient with peanut's allergie (lehmann and al. 2003). Ara h 2 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ara h on the surface of E. coli . This lippoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Der p 1 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Der p 1 (cctgtattttcagagcatgaaaatcgtgctggc). Expected size of the amplicon was 994 bp.

Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 9).

Figure 9: der fragmentFigure 9: Der p 1 amplified fragment. Expected size of the amplicons was 994 bp. PCR amplicon sizes Der p 1 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

PCR products matched expected sizes and amplicons were further purified from the gel. The Der p 1 construction was inserted into linearized pET-21 b (+)_OmpA (see Figure 6) by In-Fusion.

The In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone ( screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc; expected size of the amplicons: 1894 bp) (see Primers List). 12 positive transformants were detected (Figure 10).

Figure 10: der screeningFigure 10: identifying strains that bear pET21 b (+)_OmpA_Der p 1 by colony PCR. The expected size of the amplicons was 1894 bp. 12 positive clones were detected. PCR amplicon sizes of colonies with Der p 1 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

Four of these transformants (colonies 2, 6, 11 and 13) had their plasmid extracted by Miniprep and digested by SalI (expected size of the fragments: 6 kb and 1 kb) or double-digested by HindIII and EcoRI-HF (expected size of the fragments: 5.5 kb and 1.5 kb) to assess the assembly (Figure 11).

Figure 11: der digestionFigure 11: restriction profile of pET-21 b (+)_OmpA_Der p 1 for one of the clones. Enzymes were SalI for the simple digestion (expected sizes of the fragments were 6.0 kb and 1.0 kb) and EcoRI and HindIII for the double digestion (expected sizes of the fragments were 5.5 kb and 1.5 kb). Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The correct restriction maps were obtained for the clones which were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Der p 1.

The plasmids were finally used to transform E. coli Tuner cells to express the Ompa_Der p 1 construction at the cell membrane.

Figure 1: Xxxxxx Xxxxxxxxxxxxxxxxxxxxxxxxxxx.

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Ana o 3
- OmpA_Fel d 4

  1. Mueller, G. A.; Randall, T. A.; Glesner, J.; Pedersen, L. C.; Perera, L.; Edwards, L. L.; DeRose, E. F.; Chapman, M. D.; London, R. E.; Pomés, A. (2016). Serological, genomic and structural analyses of the major mite allergen Der p 23. Clinical & Experimental Allergy, 46(2), 365–376. doi:10.1111/cea.12680
  2. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
  3. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
    4.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 130
    Illegal NheI site found at 92
    Illegal NotI site found at 1632
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 130
    Illegal BamHI site found at 124
    Illegal XhoI site found at 1641
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 1000
    COMPATIBLE WITH RFC[1000]