Difference between revisions of "Part:BBa K4197009"
Line 4: | Line 4: | ||
Brick expressing Gal d 2 at the surface of <i>E. coli </i>. | Brick expressing Gal d 2 at the surface of <i>E. coli </i>. | ||
+ | |||
+ | <html> | ||
+ | |||
+ | <h2>Introduction</h2> | ||
+ | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | ||
+ | |||
+ | <h2>Construction</h2> | ||
+ | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | ||
+ | |||
+ | |||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:50%;"> | ||
+ | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image"> | ||
+ | <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 1: </b> <b>Xxxxxx</b> | ||
+ | Xxxxxxxxxxxxxxxxxxxxxxxxxxx. | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | <h2>Xxxxxxxxx</h2> | ||
+ | <p>Xxxxxxxxxxxxx</p> | ||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:80%;"> | ||
+ | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image"> | ||
+ | <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> | ||
+ | Xxxxxxxxxxxxx. | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <h2>titre 2</h2> | ||
+ | <h3>Titre 3</h3> | ||
+ | <p>Xxxxxxxxxx</p> | ||
+ | <ul> | ||
+ | <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li> | ||
+ | <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li> | ||
+ | </ul> | ||
+ | <p>Xxxxxxxxxx</p> | ||
+ | <ul> | ||
+ | <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li> | ||
+ | <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li> | ||
+ | </ul> | ||
+ | |||
+ | |||
+ | <h3>titre 3</h3> | ||
+ | <h4>Titre 4</h4> | ||
+ | <p>Xxxxxx</p> | ||
+ | |||
+ | |||
+ | <h4>Titre 4</h4> | ||
+ | <p>xxxxxxx</p> | ||
+ | |||
+ | <h2>Titre 2</h2> | ||
+ | <p>Xxxxxx</p> | ||
+ | <h2>References</h2> | ||
+ | <ol> | ||
+ | <i> | ||
+ | <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li> | ||
+ | <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li> | ||
+ | <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li> | ||
+ | </i> | ||
+ | </ol> | ||
+ | </html> | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Revision as of 09:23, 22 September 2022
Gal d 2_OmpA fusion
Brick expressing Gal d 2 at the surface of E. coli .
Introduction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Construction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
- Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
- Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG
Xxxxxxxxxx
- CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
- Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
- Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
- Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
- Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 130
Illegal NheI site found at 92
Illegal NheI site found at 741
Illegal NotI site found at 1830 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 130
Illegal BamHI site found at 124
Illegal XhoI site found at 1839 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 130
Illegal XbaI site found at 47 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 952