Difference between revisions of "Part:BBa K4197017"
Line 7: Line 7:
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the allergen of peanu Ara h 2 (NCBI: <a "https://www.ncbi.nlm.nih.gov/nuccore/AY158467.1/">AY158467.1</a>). The peanut allergy prevalence is superior to 5% (lieberman and al. 2018) in developped countries and Ara h 2, among the 17 other peanut allergens, triggers 90% of the patients with peanut allergy (lehmann and al. 2003). Ara h 2 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with peanut's allergie (lehmann and al. 2003).
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>The objective of the INSA-UPS 2022 team was to display Ara h 2 on the surface of <i>E. coli</i> so the ordered sequence was merged to OmpA membrane lippoprotein (see part <a href="https://parts.igem.org/Part:BBa_K4197009">BBa_K1694009</a>).</p>
−
   
+
  
−
<div class="center">
 
−
        <div class="thumb tnone">
 
−
            <div class="thumbinner" style="width:50%;">
 
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
 
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                    <div class="magnify">
 
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
−
                    </div>
 
−
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
 
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
 
−
                </div>
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
<h2>Xxxxxxxxx</h2>
 
−
<p>Xxxxxxxxxxxxx</p>
 
−
<div class="center">
 
−
    <div class="thumb tnone">
 
−
        <div class="thumbinner" style="width:80%;">
 
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
 
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                <div class="magnify">
 
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
 
−
                </div>
 
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
 
−
                Xxxxxxxxxxxxx.
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
</div>
 
−
   
 
−
<h2>titre 2</h2>
 
−
<h3>Titre 3</h3>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
  
  
−
<h3>titre 3</h3>
 
−
    <h4>Titre 4</h4>
 
−
<p>Xxxxxx</p>
 
−
 
−
                 
 
−
<h4>Titre 4</h4>
 
−
<p>xxxxxxx</p>
 
−
 
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
 
<h2>References</h2>
 
<h2>References</h2>
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Lieberman, J., Sublett, J., Ali, Y., Haselkorn, T., Damle, V., Chidambaram, A., Rosen, K., & Mahr, T. (2018). INCREASED INCIDENCE AND PREVALENCE OF PEANUT ALLERGY IN CHILDREN AND ADOLESCENTS IN THE UNITED STATES. Annals of Allergy, Asthma & ; Immunology, 121(5), S13. https://doi.org/10.1016/j.anai.2018.09.039</li>
−
    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Lehmann, K., Hoffmann, S., Neudecker, P., Suhr, M., Becker, W.-M., & Rösch, P. (2003). High-yield expression in Escherichia coli, purification, and characterization of properly folded major peanut allergen Ara h 2. Protein Expression and Purification, 31(2), 250–259. https://doi.org/10.1016/s1046-5928(03)00190-6</li>
−
     <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
 
</i>
 
</i>
 
</ol>
 
</ol>

Revision as of 15:19, 6 October 2022


Gene coding for Ara h 2

Gene coding for the panut allergen called Ara h 2.

Introduction

This part is composed of the gene coding for the allergen of peanu Ara h 2 (NCBI: AY158467.1). The peanut allergy prevalence is superior to 5% (lieberman and al. 2018) in developped countries and Ara h 2, among the 17 other peanut allergens, triggers 90% of the patients with peanut allergy (lehmann and al. 2003). Ara h 2 have already been expressed in E. coli and was able to bind the IgE of patient with peanut's allergie (lehmann and al. 2003).

Construction

The objective of the INSA-UPS 2022 team was to display Ara h 2 on the surface of E. coli so the ordered sequence was merged to OmpA membrane lippoprotein (see part BBa_K1694009).

References

  1. Lieberman, J., Sublett, J., Ali, Y., Haselkorn, T., Damle, V., Chidambaram, A., Rosen, K., & Mahr, T. (2018). INCREASED INCIDENCE AND PREVALENCE OF PEANUT ALLERGY IN CHILDREN AND ADOLESCENTS IN THE UNITED STATES. Annals of Allergy, Asthma & ; Immunology, 121(5), S13. https://doi.org/10.1016/j.anai.2018.09.039
  2. Lehmann, K., Hoffmann, S., Neudecker, P., Suhr, M., Becker, W.-M., & Rösch, P. (2003). High-yield expression in Escherichia coli, purification, and characterization of properly folded major peanut allergen Ara h 2. Protein Expression and Purification, 31(2), 250–259. https://doi.org/10.1016/s1046-5928(03)00190-6
    3.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 186
    Illegal BamHI site found at 207
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 86