Difference between revisions of "Part:BBa K4197014"
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4197014 short</partinfo>
 
<partinfo>BBa_K4197014 short</partinfo>
−
<span class='h3bb'>Sequence and Features</span>
+
 
−
<partinfo>BBa_K4197014 SequenceAndFeatures</partinfo>
+
Constitutive promoter of <i>E. coli</i>.
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>This part is composed of the gene coding for the 800 first bp of the ihfB promoter. This promoter has been identified as a constitutive <i>E. coli</i> promoter (Weglenska et al., 1996). It is often used by researchers of the Toulouse Biotechnology Institute to express recombinant fluorescent proteins in <i>E. coli</i> (Barthe et al., 2020), as it is strong enough to allow correct expression and weak enough to avoid inclusion bodies.</p>
 +
 
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
 
−
   
 
  
−
<div class="center">
+
<p>The objective of the INSA-UPS 2022 team was to use ihfB800 promoter to express mTagBFP (<a href="https://parts.igem.org/Part:BBa_K4197013">BBa_K4197013</a>), mRFP1 (<a href="https://parts.igem.org/Part:BBa_K4197012">BBa K4197012</a>), and mScarlet-I (<a href="https://parts.igem.org/Part:BBa_K4197022">BBa_K4197022</a>) into <i>E. coli</i> Tuner (DE3) cells. The functionality of the promoter was confirmed as the mTagBFP and mScarlet-I were successfully expressed.</p>
−
        <div class="thumb tnone">
+
                                             
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
+
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
+
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<h2>Xxxxxxxxx</h2>
+
−
<p>Xxxxxxxxxxxxx</p>
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
+
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                 <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
+
−
                Xxxxxxxxxxxxx.
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
</div>
+
−
   
+
−
<h2>titre 2</h2>
+
−
<h3>Titre 3</h3>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
−
<p>Xxxxxxxxxx</p>
+
−
<ul>
+
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
+
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
+
−
</ul>
+
  
−
 
−
<h3>titre 3</h3>
 
−
    <h4>Titre 4</h4>
 
−
<p>Xxxxxx</p>
 
−
 
−
                 
 
−
<h4>Titre 4</h4>
 
−
<p>xxxxxxx</p>
 
−
 
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
 
<h2>References</h2>
 
<h2>References</h2>
 +
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
     <li>Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4</li>
−
     <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
     <li>Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20</i>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
−
</i>
+
 
</ol>
 
</ol>
 
</html>
 
</html>

Revision as of 10:45, 8 October 2022


ihfB800 promoter

Constitutive promoter of E. coli.

Introduction

This part is composed of the gene coding for the 800 first bp of the ihfB promoter. This promoter has been identified as a constitutive E. coli promoter (Weglenska et al., 1996). It is often used by researchers of the Toulouse Biotechnology Institute to express recombinant fluorescent proteins in E. coli (Barthe et al., 2020), as it is strong enough to allow correct expression and weak enough to avoid inclusion bodies.

Construction

The objective of the INSA-UPS 2022 team was to use ihfB800 promoter to express mTagBFP (BBa_K4197013), mRFP1 (BBa K4197012), and mScarlet-I (BBa_K4197022) into E. coli Tuner (DE3) cells. The functionality of the promoter was confirmed as the mTagBFP and mScarlet-I were successfully expressed.

References

  1. Wȩgleńska, A., Jacob, B., & Sirko, A. (1996). Transcriptional pattern of Escherichia coli ihfB (himD) gene expression. Gene, 181(1-2), 85–88. https://doi.org/10.1016/s0378-1119(96)00468-4
  2. Barthe, M., Tchouanti, J., Gomes, P. H., Bideaux, C., Lestrade, D., Graham, C., Steyer, J.-P., Meleard, S., Harmand, J., Gorret, N., Cocaign-Bousquet, M., & Enjalbert, B. (2020). Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose. mBio, 11(6), Article e02938-20. https://doi.org/10.1128/mbio.02938-20

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
  • 1000
    COMPATIBLE WITH RFC[1000]