Difference between revisions of "Collections/BIOFAB"
(→References) |
(→References) |
||
Line 798: | Line 798: | ||
<html> | <html> | ||
<p> | <p> | ||
− | Mutalik, V., Guimaraes, J., Cambray, G. et al. Quantitative estimation of activity and quality for collections of functional genetic elements. Nat Methods 10, 347–353 (2013). https://doi.org/10.1038/nmeth.2403 | + | Mutalik, V., Guimaraes, J., Cambray, G. et al. Quantitative estimation of activity and quality for collections of functional genetic elements. Nat Methods 10, 347–353 (2013). <a href:"https://doi.org/10.1038/nmeth.2403">https://doi.org/10.1038/nmeth.2403</a> |
</p> | </p> | ||
<p> | <p> | ||
− | Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404 | + | Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). <a href:"https://doi.org/10.1038/nmeth.2404">https://doi.org/10.1038/nmeth.2404</a> |
</p> | </p> | ||
Revision as of 23:17, 23 July 2022
This collection is curated by the FSU iGEM teams
How is the BIOFAB collection useful to you?
The BIOFAB collection contains constitutive promoters, transcription terminators, and 5' untranslated regions (5' UTRs). The promoters and terminators were added to the iGEM Parts Registry by the 2018 and 2020 FSU iGEM teams. The promoters have a range of strength that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on the desired levels of gene expression. The original BIOFAB promoters and terminators were tested using a specific transcription unit designed by the BIOFAB team. The FSU iGEM teams are measuring the strength of the promoters in a genetic context composed of iGEM parts. Specifically, using the pSB1C3 and pSB1K3 backbones. It is recommend that users of the BIOFAB Collection select several promoters with the desired strength when working on a new design to determine experimentally which promoter provides the desired level of gene expression.
How do the BIOFAB promoters work?
The promoters on this page are listed in order of decreasing strength based on the measurements reported by the BIOFAB team. The strongest promoters are expected to produce more messenger RNA (mRNA) than the weaker promoters. The promoter strength is determined by how frequently the DNA sequence recruits RNA polymerases and encourages transcription.
How are the BIOFAB promoters being measured?
The FSU iGEM teams are measuring the strengths of the BIOFAB promoters in a measurement device composed of a BIOFAB promoter, a ribosome binding site (BBa_B0034), mRFP1 (BBa_E1010), and a terminator (BBa_B0015). The measurement devices are inserted into pSB1C3 and pSB1K3 backbones using a scarless DNA assembly method (NEB HiFi DNA Assembly). The resulting plasmid vectors are used to transform the E. coli NEBExpress chassis. The promoter strengths are measured via the amount of fluorescence detected in a flow cytometer. The levels of fluorescence are reported in molecules of equivalent PE-Texas Red (MEPTR) units.
Libraries
Modular Promoter Library
Randomized Promoter Library
Terminator Library
References
Mutalik, V., Guimaraes, J., Cambray, G. et al. Quantitative estimation of activity and quality for collections of functional genetic elements. Nat Methods 10, 347–353 (2013). https://doi.org/10.1038/nmeth.2403
Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404
Cambray, G., Guimaraes, J.C., Mutalik, V.K., Lam, C., Mai, Q.A., Thimmaiah, T., Carothers, J.M., Arkin, A.P. and Endy, D., 2013. Measurement and modeling of intrinsic transcription terminators. Nucleic acids research, 41(9), pp.5139-5148.
The data visualization is provided by the Charts.css library. You can use the Charts.css 0.9.0 library in your wiki page by adding the {{FSU/ChartsCSS}} template to the page.
Tables Generated by the Parts Registry
Modular Promoters Table
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K2832100 | BIOFAB Modular Promoter apFAB46 | Regulatory | BIOFAB | 47 | 1 | . . . cgcatctttttgtacctataatagattcat |
BBa_K2832101 | BIOFAB Modular Promoter apFAB70 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832102 | BIOFAB Modular Promoter apFAB71 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832103 | BIOFAB Modular Promoter apFAB61 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832104 | BIOFAB Modular Promoter apFAB80 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832105 | BIOFAB Modular Promoter apFAB45 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832106 | BIOFAB Modular Promoter apFAB47 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832107 | BIOFAB modular Promoter apFAB31 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832108 | BIOFAB modular Promoter apFAB55 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832109 | BIOFAB modular Promoter apFAB68 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832110 | BIOFAB modular Promoter apFAB101 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832111 | BIOFAB Modular Promoter apFAB96 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832112 | BIOFAB Modular Promoter apFAB56 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832113 | BIOFAB Modular Promoter apFAB81 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832114 | BIOFAB Modular Promoter apFAB92 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832115 | BIOFAB Modular Promoter apFAB72 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832116 | BIOFAB Modular Promoter apFAB100 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832117 | BIOFAB Modular Promoter apFAB76 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832118 | BIOFAB Modular Promoter apFAB30 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832119 | BIOFAB Modular Promoter apFAB79 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832120 | BIOFAB Modular Promoter apFAB75 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832121 | BIOFAB Modular Promoter apFAB50 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832122 | BIOFAB Modular Promoter apFAB93 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832123 | BIOFAB Modular Promoter apFAB60 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832124 | BIOFAB Modular Promoter apFAB54 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832125 | BIOFAB Modular Promoter apFAB62 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832126 | BIOFAB Modular Promoter apFAB42 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832127 | BIOFAB Modular Promoter apFAB53 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832128 | BIOFAB Modular Promoter apFAB85 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832129 | BIOFAB Modular Promoter apFAB65 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832130 | BIOFAB Modular Promoter apFAB52 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832131 | BIOFAB Modular Promoter apFAB67 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832132 | BIOFAB Modular Promoter apFAB32 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832133 | BIOFAB Modular Promoter apFAB57 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832134 | BIOFAB Modular Promoter apFAB39 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832135 | BIOFAB Modular Promoter apFAB115 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832136 | BIOFAB Modular Promoter apFAB29 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832137 | BIOFAB Modular Promoter apFAB77 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832138 | BIOFAB Modular Promoter apFAB36 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832139 | BIOFAB Modular Promoter apFAB44 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832140 | BIOFAB Modular Promoter apFAB102 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832141 | BIOFAB Modular Promoter apFAB37 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832142 | BIOFAB Modular Promoter apFAB41 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832143 | BIOFAB Modular Promoter apFAB63 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832144 | BIOFAB Modular Promoter apFAB140 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832145 | bIOFAB Modular Promoter apFAB64 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832146 | BIOFAB Modular Promoter apFAB40 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtataatgtgtggat | |
BBa_K2832147 | BIOFAB Modular Promoter apFAB97 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832148 | BIOFAB modular Promoter apFAB78 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832149 | BIOFAB Modular Promoter apFAB69 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832150 | BIOFAB Modular Promoter apFAB103 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832151 | BIOFAB Modular Promoter apFAB73 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832152 | BIOFAB Modular Promoter apFAB66 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832153 | BIOFAB Modular Promoter apFAB126 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832154 | BIOFAB Modular Promoter apFAB95 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832155 | BIOFAB Modular Promoter apFAB151 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832156 | BIOFAB Modular Promoter apFAB48 | Regulatory | BIOFAB | 47 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832157 | BIOFAB Modular Promoter apFAB82 | Regulatory | BIOFAB | 49 | 1 | . . . aagtctaacctataggcataattatttcat |
BBa_K2832158 | BIOFAB Modular Promoter apFAB141 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832159 | BIOFAB Modular Promoter apFAB150 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832160 | BIOFAB Modular Promoter apFAB125 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatataatgtgtggat | |
BBa_K2832161 | BIOFAB Modular Promoter apFAB33 | Regulatory | BIOFAB | 48 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832162 | BIOFAB Modular Promoter apFAB121 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832163 | BIOFAB modular Promoter apFAB111 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832164 | BIOFAB modular Promoter apFAB58 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832165 | BIOFAB modular Promoter apFAB94 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832166 | BIOFAB modular Promoter apFAB145 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832167 | BIOFAB Modular Promoter apFAB118 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832168 | BIOFAB Modular Promoter apFAB106 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832169 | BIOFAB Modular Promoter apFAB110 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832170 | BIOFAB Modular Promoter apFAB105 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832171 | BIOFAB Modular Promoter apFAB38 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832172 | BIOFAB Modular Promoter apFAB89 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832173 | BIOFAB Modular Promoter apFAB142 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832174 | BIOFAB Modular Promoter apFAB130 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtataatgtgtggat | |
BBa_K2832175 | BIOFAB Modular Promoter apFAB131 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtataatagattcat | |
BBa_K2832176 | BIOFAB Modular Promoter apFAB143 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832177 | BIOFAB Modular Promoter apFAB87 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832178 | BIOFAB Modular Promoter apFAB104 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832179 | BIOFAB Modular Promoter apFAB98 | Regulatory | BIOFAB | 48 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832180 | BIOFAB Modular Promoter apFAB51 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgatataatagattcat | |
BBa_K2832181 | BIOFAB Modular Promoter apFAB49 | Regulatory | BIOFAB | 47 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832182 | BIOFAB Modular Promoter apFAB120 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctataatgtgtggat | |
BBa_K2832183 | BIOFAB Modular Promoter apFAB83 | Regulatory | BIOFAB | 49 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832184 | BIOFAB Modular Promoter apFAB117 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgcataattatttcat | |
BBa_K2832185 | BIOFAB Modular Promoter apFAB129 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggatacttacagccat | |
BBa_K2832186 | BIOFAB Modular Promoter apFAB146 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctataatagattcat | |
BBa_K2832187 | BIOFAB Modular Promoter apFAB59 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832188 | BIOFAB Modular Promoter apFAB127 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832189 | BIOFAB Modular Promoter apFAB88 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832190 | BIOFAB Modular Promoter apFAB86 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832191 | BIOFAB Modular Promoter apFAB74 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832192 | BIOFAB Modular Promoter apFAB152 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgacataattatttcat | |
BBa_K2832193 | BIOFAB Modular Promoter apFAB122 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832194 | BIOFAB Modular Promoter apFAB128 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgatagatttaacgtat | |
BBa_K2832195 | BIOFAB Modular Promoter apFAB99 | Regulatory | BIOFAB | 48 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832196 | BIOFAB Modular Promoter apFAB119 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832197 | BIOFAB Modular Promoter apFAB112 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832198 | BIOFAB Modular Promoter apFAB34 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832199 | BIOFAB Modular Promoter apFAB147 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacccataattatttcat | |
BBa_K2832200 | BIOFAB Modular Promoter apFAB144 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtaccatacttacagccat | |
BBa_K2832201 | BIOFAB Modular Promoter apFAB35 | Regulatory | BIOFAB | 47 | . . . ttaatcatccggctcgtataatgtgtggat | |
BBa_K2832202 | BIOFAB modular Promoter apFAB107 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggcataattatttcat | |
BBa_K2832203 | BIOFAB modular Promoter apFAB123 | Regulatory | BIOFAB | 37 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832204 | BIOFAB Modular Promoter apFAB137 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgcataattatttcat | |
BBa_K2832205 | BIOFAB Modular Promoter apFAB113 | Regulatory | BIOFAB | 37 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832206 | BIOFAB Modular Promoter apFAB84 | Regulatory | BIOFAB | 48 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832207 | BIOFAB Modular Promoter apFAB148 | Regulatory | BIOFAB | 45 | . . . cgcatctttttgtacctagatttaacgtat | |
BBa_K2832208 | BIOFAB Modular Promoter apFAB108 | Regulatory | BIOFAB | 38 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832209 | BIOFAB Modular Promoter apFAB114 | Regulatory | BIOFAB | 37 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832210 | BIOFAB Modular Promoter apFAB136 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgtataatagattcat | |
BBa_K2832211 | BIOFAB Modular Promoter apFAB124 | Regulatory | BIOFAB | 37 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832212 | BIOFAB Modular Promoter apFAB149 | Regulatory | BIOFAB | 45 | . . . ttatcccttgcggcgaatacttacagccat | |
BBa_K2832213 | BIOFAB Modular Promoter apFAB134 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgatacttacagccat | |
BBa_K2832214 | BIOFAB Modular Promoter apFAB138 | Regulatory | BIOFAB | 45 | . . . ttaatcatccggctcgtagatttaacgtat | |
BBa_K2832215 | BIOFAB Modular Promoter apFAB43 | Regulatory | BIOFAB | 47 | . . . caggaaaatttttctgtagatttaacgtat | |
BBa_K2832216 | BIOFAB Modular Promoter apFAB133 | Regulatory | BIOFAB | 46 | . . . aagtctaacctataggtagatttaacgtat | |
BBa_K2832217 | BIOFAB Modular Promoter apFAB139 | Regulatory | BIOFAB | 45 | . . . caggaaaatttttctgatacttacagccat | |
BBa_K2832218 | BIOFAB Modular Promoter apFAB91 | Regulatory | BIOFAB | 48 | . . . caggaaaatttttctgtataatagattcat | |
BBa_K2832219 | BIOFAB Modular Promoter apFAB90 | Regulatory | BIOFAB | 48 | 1 | . . . caggaaaatttttctgtataatgtgtggat |
Randomized Promoters Table
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_J97008 | BIOFAB Random Promoter apFAB342 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataaaatttgtgga |
BBa_K3702000 | BIOFAB Random Promoter apFAB347 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaatatgtgtgga |
BBa_K3702001 | BIOFAB Random Promoter apFAB345 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagagtatgtgga |
BBa_K3702002 | BIOFAB Random Promoter apFAB341 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatatgtgtgga |
BBa_K3702003 | BIOFAB Random Promoter apFAB317 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702004 | BIOFAB Random Promoter apFAB338 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaggatgtgtgga |
BBa_K3702005 | BIOFAB Random Promoter apFAB323 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702006 | BIOFAB Random Promoter apFAB339 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatttatgtgga |
BBa_K3702007 | BIOFAB Random Promoter apFAB321 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaacttatgtgga |
BBa_K3702008 | BIOFAB Random Promoter apFAB340 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtatgtgtgga |
BBa_K3702009 | BIOFAB Random Promoter apFAB322 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702010 | BIOFAB Random Promoter apFAB346 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaatgtttgtgga |
BBa_K3702011 | BIOFAB Random Promoter apFAB303 | Regulatory | BIOFAB | 35 | -1 | . . . tcttaatcatcggctcgtataatgtgtgga |
BBa_K3702012 | BIOFAB Random Promoter apFAB302 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702013 | BIOFAB Random Promoter apFAB297 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702014 | BIOFAB Random Promoter apFAB301 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702015 | BIOFAB Random Promoter apFAB298 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702016 | BIOFAB Random Promoter apFAB306 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtgtttgtgga |
BBa_K3702017 | BIOFAB Random Promoter apFAB307 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatcgtttgtgga |
BBa_K3702018 | BIOFAB Random Promoter apFAB296 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702019 | BIOFAB Random Promoter apFAB308 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaggttatgtgga |
BBa_K3702020 | BIOFAB Random Promoter apFAB295 | Regulatory | BIOFAB | 35 | -1 | . . . tcttaatcatcggctcgtataatgtgtgga |
BBa_K3702021 | BIOFAB Random Promoter apFAB300 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702022 | BIOFAB Random Promoter apFAB299 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702023 | BIOFAB Random Promoter apFAB309 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtgtctgtgga |
BBa_K3702024 | BIOFAB Random Promoter apFAB305 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagggtttgtgga |
BBa_K3702025 | BIOFAB Random Promoter apFAB313 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagggtgtgtgga |
BBa_K3702026 | BIOFAB Random Promoter apFAB310 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctatcttctgtgga |
BBa_K3702027 | BIOFAB Random Promoter apFAB311 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtaggttgtgtgga |
BBa_K3702028 | BIOFAB Random Promoter apFAB279 | Regulatory | BIOFAB | 35 | -1 | . . . ctttaatcatcggctcgtataatgtgtgga |
BBa_K3702029 | BIOFAB Random Promoter apFAB314 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaagttgtgtgga |
BBa_K3702030 | BIOFAB Random Promoter apFAB281 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702031 | BIOFAB Random Promoter apFAB276 | Regulatory | BIOFAB | 35 | -1 | . . . tattaatcatcggctcgtataatgtgtgga |
BBa_K3702032 | BIOFAB Random Promoter apFAB312 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagtgtttgtgga |
BBa_K3702033 | BIOFAB Random Promoter apFAB273 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702034 | BIOFAB Random Promoter apFAB316 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatagtatgtgga |
BBa_K3702035 | BIOFAB Random Promoter apFAB282 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702036 | BIOFAB Random Promoter apFAB260 | Regulatory | BIOFAB | 35 | -1 | . . . tgttaatcatcggctcgtataatgtgtgga |
BBa_K3702037 | BIOFAB Random Promoter apFAB293 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaggttgtgtgga |
BBa_K3702038 | BIOFAB Random Promoter apFAB259 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702039 | BIOFAB Random Promoter apFAB284 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataagttttgtgga |
BBa_K3702040 | BIOFAB Random Promoter apFAB285 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagcctctgtgga |
BBa_K3702041 | BIOFAB Random Promoter apFAB286 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagtttttgtgga |
BBa_K3702042 | BIOFAB Random Promoter apFAB257 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702043 | BIOFAB Random Promoter apFAB267 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagggtctgtgga |
BBa_K3702044 | BIOFAB Random Promoter apFAB263 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702045 | BIOFAB Random Promoter apFAB262 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702046 | BIOFAB Random Promoter apFAB265 | Regulatory | BIOFAB | 35 | -1 | . . . tattaatcatcggctcatccattatgtgga |
BBa_K3702047 | BIOFAB Random Promoter apFAB271 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttagcgtgtgtgga |
BBa_K3702048 | BIOFAB Random Promoter apFAB278 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702049 | BIOFAB Random Promoter apFAB241 | Regulatory | BIOFAB | 35 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702050 | BIOFAB Random Promoter apFAB280 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702051 | BIOFAB Random Promoter apFAB254 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702052 | BIOFAB Random Promoter apFAB266 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggctatgtgga |
BBa_K3702053 | BIOFAB Random Promoter apFAB270 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcataaagtgtgtgga |
BBa_K3702054 | BIOFAB Random Promoter apFAB287 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagggtttgtgga |
BBa_K3702055 | BIOFAB Random Promoter apFAB256 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702056 | BIOFAB Random Promoter apFAB253 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702057 | BIOFAB Random Promoter apFAB264 | Regulatory | BIOFAB | 35 | -1 | . . . ctttaatcatcggctcgtataatgtgtgga |
BBa_K3702058 | BIOFAB Random Promoter apFAB337 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702059 | BIOFAB Random Promoter apFAB261 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702060 | BIOFAB Random Promoter apFAB272 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcgtagagtttgtgga |
BBa_K3702061 | BIOFAB Random Promoter apFAB274 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702062 | BIOFAB Random Promoter apFAB258 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagtttctgtgga |
BBa_K3702063 | BIOFAB Random Promoter apFAB255 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcgtataatgtgtgga |
BBa_K3702064 | BIOFAB Random Promoter apFAB268 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagcgtgtgtgga |
BBa_K3702065 | BIOFAB Random Promoter apFAB333 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702066 | BIOFAB Random Promoter apFAB326 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702067 | BIOFAB Random Promoter apFAB343 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagcgtctgtgga |
BBa_K3702068 | BIOFAB Random Promoter apFAB329 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtatcatatgtgga |
BBa_K3702069 | BIOFAB Random Promoter apFAB332 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702070 | BIOFAB Random Promoter apFAB252 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatatgctttgtgga |
BBa_K3702071 | BIOFAB Random Promoter apFAB251 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaggttctgtgga |
BBa_K3702072 | BIOFAB Random Promoter apFAB226 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatctgtgga |
BBa_K3702073 | BIOFAB Random Promoter apFAB315 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702074 | BIOFAB Random Promoter apFAB335 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702075 | BIOFAB Random Promoter apFAB334 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702076 | BIOFAB Random Promoter apFAB319 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702077 | BIOFAB Random Promoter apFAB229 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702078 | BIOFAB Random Promoter apFAB228 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702079 | BIOFAB Random Promoter apFAB225 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctataatttgtgga |
BBa_K3702080 | BIOFAB Random Promoter apFAB224 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtagagtgtgtgga |
BBa_K3702081 | BIOFAB Random Promoter apFAB324 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggctttgtgga |
BBa_K3702082 | BIOFAB Random Promoter apFAB230 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702083 | BIOFAB Random Promoter apFAB318 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtataatgtgtgga |
BBa_K3702084 | BIOFAB Random Promoter apFAB331 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcggagactttgtgga |
BBa_K3702085 | BIOFAB Random Promoter apFAB304 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702086 | BIOFAB Random Promoter apFAB231 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtataatgtgtgga |
BBa_K3702087 | BIOFAB Random Promoter apFAB227 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702088 | BIOFAB Random Promoter apFAB209 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702089 | BIOFAB Random Promoter apFAB202 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatctgtgga |
BBa_K3702090 | BIOFAB Random Promoter apFAB212 | Regulatory | BIOFAB | 35 | -1 | . . . ttttaatcatcggctcgtataatgtgtgga |
BBa_K3702091 | BIOFAB Random Promoter apFAB211 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702092 | BIOFAB Random Promoter apFAB221 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatagactgtgtgga |
BBa_K3702093 | BIOFAB Random Promoter apFAB205 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtattatatgtgga |
BBa_K3702094 | BIOFAB Random Promoter apFAB201 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcctatagtgtgtgga |
BBa_K3702095 | BIOFAB Random Promoter apFAB193 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702096 | BIOFAB Random Promoter apFAB203 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtagtctgtgtgga |
BBa_K3702097 | BIOFAB Random Promoter apFAB200 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttagggtttgtgga |
BBa_K3702098 | BIOFAB Random Promoter apFAB207 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcatatactttgtgga |
BBa_K3702099 | BIOFAB Random Promoter apFAB206 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcgtaccctttgtgga |
BBa_K3702101 | BIOFAB Random Promoter apFAB208 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702102 | BIOFAB Random Promoter apFAB181 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtaaactgtgtgga |
BBa_K3702103 | BIOFAB Random Promoter apFAB204 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctagtgtatgtgga |
BBa_K3702104 | BIOFAB Random Promoter apFAB190 | Regulatory | BIOFAB | 35 | -1 | . . . cgttaatcatcggctcgtataatgtgtgga |
BBa_K3702105 | BIOFAB Random Promoter apFAB189 | Regulatory | BIOFAB | 35 | -1 | . . . ccttaatcatcggctcgtataatgtgtgga |
BBa_K3702106 | BIOFAB Random Promoter apFAB184 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtacgatgtgtgga |
BBa_K3702107 | BIOFAB Random Promoter apFAB215 | Regulatory | BIOFAB | 35 | -1 | . . . ggttaatcatcggctcgtataatgtgtgga |
BBa_K3702108 | BIOFAB Random Promoter apFAB168 | Regulatory | BIOFAB | 35 | -1 | . . . cctaatcatccggctcgtataatgtgtgga |
BBa_K3702109 | BIOFAB Random Promoter apFAB197 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcttaggttttgtgga |
BBa_K3702110 | BIOFAB Random Promoter apFAB199 | Regulatory | BIOFAB | 35 | -1 | . . . attaatcatccggctcgtagtgtgtgtgga |
BBa_K3702111 | BIOFAB Random Promoter apFAB216 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702112 | BIOFAB Random Promoter apFAB180 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtattgtatgtgga |
BBa_K3702113 | BIOFAB Random Promoter apFAB187 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtatagtctgtgga |
BBa_K3702114 | BIOFAB Random Promoter apFAB182 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcttaacttgtgtgga |
BBa_K3702115 | BIOFAB Random Promoter apFAB186 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtatgttctgtgga |
BBa_K3702116 | BIOFAB Random Promoter apFAB183 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcctaggttatgtgga |
BBa_K3702117 | BIOFAB Random Promoter apFAB195 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcggaaagaatgtgga |
BBa_K3702118 | BIOFAB Random Promoter apFAB167 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcataaaatttgtgga |
BBa_K3702119 | BIOFAB Random Promoter apFAB177 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcaggtgtaatgtgga |
BBa_K3702120 | BIOFAB Random Promoter apFAB192 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcgtataatgtgtgga |
BBa_K3702121 | BIOFAB Random Promoter apFAB220 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcatatggtctgtgga |
BBa_K3702122 | BIOFAB Random Promoter apFAB161 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcttagagtatgtgga |
BBa_K3702123 | BIOFAB Random Promoter apFAB160 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatccggctcttatagtttgtgga |
BBa_K3702124 | BIOFAB Random Promoter apFAB162 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcgtagtctgtgtgga |
BBa_K3702125 | BIOFAB Random Promoter apFAB159 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctagcatgtgtgga |
BBa_K3702126 | BIOFAB Random Promoter apFAB164 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcttaccgtttgtgga |
BBa_K3702127 | BIOFAB Random Promoter apFAB166 | Regulatory | BIOFAB | 36 | -1 | . . . cttaatcatctggctcatagtttatgtgga |
BBa_K3702128 | BIOFAB Random Promoter apFAB157 | Regulatory | BIOFAB | 36 | -1 | . . . attaatcatccggctcatattttttgtgga |
BBa_K3702129 | BIOFAB Random Promoter apFAB217 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatcatcggctcctagggtttgtgga |
BBa_K3702130 | BIOFAB Random Promoter apFAB156 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcctagtttgtgtgga |
BBa_K3702131 | BIOFAB Random Promoter apFAB213 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcgtataatgtgtgga |
BBa_K3702132 | BIOFAB Random Promoter apFAB325 | Regulatory | BIOFAB | 35 | -1 | . . . aattaatatccggctcgtagcgtctgtgga |
BBa_K3702133 | BIOFAB Random Promoter apFAB188 | Regulatory | BIOFAB | 35 | -1 | . . . ccttaatcatcggctcgtataatgtgtgga |
BBa_K3702134 | BIOFAB Random Promoter apFAB210 | Regulatory | BIOFAB | 35 | -1 | . . . cgttaatcatcggctcgtataatgtgtgga |
BBa_K3702135 | BIOFAB Random Promoter apFAB327 | Regulatory | BIOFAB | 36 | -1 | . . . tttaatcatccggctcctactctgtgtgga |
BBa_K3702136 | BIOFAB Random Promoter apFAB294 | Regulatory | BIOFAB | 36 | -1 | . . . gttaatcatccggctcataaaatttgtgga |
Terminators Table
Name | Description | Type | Created by | length | uses | seq |
---|---|---|---|---|---|---|
BBa_K3702161 | BIOFAB Terminator apFAB376 | Terminator | BIOFAB | 34 | -1 | . . . aaaaaccccgcttcggcggggttttttcgc |
BBa_K3702173 | BIOFAB Terminator apFAB388 | Terminator | BIOFAB | 39 | -1 | . . . ccccgcccctgacagggcggggtttttttt |
BBa_K3702137 | BIOFAB Terminator apFAB352 | Terminator | BIOFAB | 86 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702138 | BIOFAB Terminator apFAB353 | Terminator | BIOFAB | 50 | -1 | . . . atatttcgattgcatgtgcaattttttgca |
BBa_K3702139 | BIOFAB Terminator apFAB354 | Terminator | BIOFAB | 33 | -1 | . . . tcgcaaaaaaccccgctggggttttttcgc |
BBa_K3702140 | BIOFAB Terminator apFAB355 | Terminator | BIOFAB | 80 | -1 | . . . tgtctattatccctaagcccattttttgca |
BBa_K3702141 | BIOFAB Terminator apFAB356 | Terminator | BIOFAB | 121 | -1 | . . . tgcactaagcacataattgctcacagccaa |
BBa_K3702142 | BIOFAB Terminator apFAB357 | Terminator | BIOFAB | 52 | -1 | . . . gatacccagcccgcctaatcaatgcaaaca |
BBa_K3702143 | BIOFAB Terminator apFAB358 | Terminator | BIOFAB | 31 | -1 | . . . gcaaaaaaccccgctgcggggttttttcgc |
BBa_K3702144 | BIOFAB Terminator apFAB359 | Terminator | BIOFAB | 83 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702145 | BIOFAB Terminator apFAB360 | Terminator | BIOFAB | 40 | -1 | . . . tgtctattatccctaagcccattttttgca |
BBa_K3702146 | BIOFAB Terminator apFAB361 | Terminator | BIOFAB | 105 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702147 | BIOFAB Terminator apFAB362 | Terminator | BIOFAB | 80 | -1 | . . . cagccgcctgtcgcccgaaggccggtcggc |
BBa_K3702148 | BIOFAB Terminator apFAB363 | Terminator | BIOFAB | 91 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702149 | BIOFAB Terminator apFAB364 | Terminator | BIOFAB | 102 | -1 | . . . cgataaagaagatttagcttcaaataaaac |
BBa_K3702150 | BIOFAB Terminator apFAB365 | Terminator | BIOFAB | 108 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702151 | BIOFAB Terminator apFAB366 | Terminator | BIOFAB | 109 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702152 | BIOFAB Terminator apFAB367 | Terminator | BIOFAB | 83 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702153 | BIOFAB Terminator apFAB368 | Terminator | BIOFAB | 96 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702154 | BIOFAB Terminator apFAB369 | Terminator | BIOFAB | 106 | -1 | . . . cagccgtatgacaaggtcggcatcaggtgt |
BBa_K3702155 | BIOFAB Terminator apFAB370 | Terminator | BIOFAB | 97 | -1 | . . . gcgcggttgataacggttcagacaggttta |
BBa_K3702156 | BIOFAB Terminator apFAB371 | Terminator | BIOFAB | 93 | -1 | . . . cccccgatgtggcgcagactgatttatcac |
BBa_K3702157 | BIOFAB Terminator apFAB372 | Terminator | BIOFAB | 91 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702158 | BIOFAB Terminator apFAB373 | Terminator | BIOFAB | 84 | -1 | . . . attactcaacaggtaaggcgcgaggttttc |
BBa_K3702159 | BIOFAB Terminator apFAB374 | Terminator | BIOFAB | 104 | -1 | . . . ttgggtcagtcgtataaaggtcattacgga |
BBa_K3702160 | BIOFAB Terminator apFAB375 | Terminator | BIOFAB | 80 | -1 | . . . tcccgatcttaatgaatggccggaagtggt |
BBa_K3702162 | BIOFAB Terminator apFAB377 | Terminator | BIOFAB | 91 | -1 | . . . gggggagagggaagtcatgaaaaaactaac |
BBa_K3702163 | BIOFAB Terminator apFAB378 | Terminator | BIOFAB | 91 | -1 | . . . caagcagcagattacgcgcagaaaaaaagg |
BBa_K3702164 | BIOFAB Terminator apFAB379 | Terminator | BIOFAB | 85 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702165 | BIOFAB Terminator apFAB380 | Terminator | BIOFAB | 85 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702166 | BIOFAB Terminator apFAB381 | Terminator | BIOFAB | 90 | -1 | . . . ttccgggcattaaccctcactaacaggaga |
BBa_K3702167 | BIOFAB Terminator apFAB382 | Terminator | BIOFAB | 87 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702168 | BIOFAB Terminator apFAB383 | Terminator | BIOFAB | 88 | -1 | . . . tttataaggagacactttatgtttaagaag |
BBa_K3702169 | BIOFAB Terminator apFAB384 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacgctctcctg |
BBa_K3702170 | BIOFAB Terminator apFAB385 | Terminator | BIOFAB | 87 | -1 | . . . gaacaaaattagagaataacaatgcaaaca |
BBa_K3702171 | BIOFAB Terminator apFAB386 | Terminator | BIOFAB | 85 | -1 | . . . ggagattttcaacatgaaaaaattattatt |
BBa_K3702172 | BIOFAB Terminator apFAB387 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacgctctcctg |
BBa_K3702174 | BIOFAB Terminator apFAB389 | Terminator | BIOFAB | 91 | -1 | . . . atctgttgtttgtcggtgaacactctcccg |
BBa_K3702175 | BIOFAB Terminator apFAB390 | Terminator | BIOFAB | 89 | -1 | . . . gaccttaaaaacataaccgaggagcagaca |
BBa_K3702176 | BIOFAB Terminator apFAB391 | Terminator | BIOFAB | 82 | -1 | . . . tttggaggggcagaaagatgaatgactgtc |