Difference between revisions of "Part:BBa K3886005"

Revision as of 00:04, 20 October 2021

NDNFCHINAiGEM2021 Barcode

This is a part used to encode "NDNFCHINAIGEM2021“ into DNA Sequence.

Characterization

In the Hidro system(for more information about Hidro, please visit: NDNF_China Description), we have incorporated a user-defined DNA barcode into engineered strains, which stores user-defined information to distinguish engineered bacteria from natural bacteria. This Barcode can effectively help researchers track possible escaped bacterial individuals and distinct engineered strains or natural ones in an out-of-lab environment.

To design the desired barcode, we used online tools to generate a DNA Barcode sequence to store "NDNFCHINAIGEM2021“ in the DNA sequence “CTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT”.

Since the Barcode needs to be subsequently detected by CRISPR-Cas12a based nucleic acids, we added the PAM sequence (TTTA) required for Cas12a at the 3' end of the Barcode. So the final sequence is "TTTACTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT" (Figure 1).

Figure 1: The code table for translating information into DNA barcode.

The Barcode designed here was then integrated into the E. coli Top10 genome fimA site (Figure 2).

Figure 2: The gel image of the result of genome integration of DNA barcode into fimA site (a kill switch is also integrated into the genome with DNA barcode. For more information, please visit: NDNF_China Proof-Of-Concept.)

Once the Hidro system is performing a task or finishing a task, we can apply the barcode to perform the detection assay to know whether there are any escape events happening. CRISPR-Cas12a could efficiently detect the samples mimicking strain escape from Hidro. A band will be shown on a test strip when the CRISPR-Cas12a-crRNA complex detects the barcode on the E. coli genome (Figure 3). Theoretically, the detection limit could be as low as 10 aM, which greatly increases the sensitivity to detect very low-possibility escaped individuals throughout the Hidro system and allows us to more easily and dynamically monitor the development of escape events. For more information, please visit: NDNF_China Proof-Of-Concept.

Figure 5: (A) A user-customizable kill switch could eliminate any potential risk of escape; (B) The viability of E. coli with the Kid kill switch with or withour L-arabinose inducer.

Sequence and Features