Difference between revisions of "Part:BBa K3886005"

Revision as of 22:56, 19 October 2021

NDNFCHINAiGEM2021 Barcode

This is a part used to encode "NDNFCHINAIGEM2021“ into DNA Sequence.

Characterization

In the Hidro system(for more information about Hidro, please visit: NDNF_China Description), we have incorporated a user-defined DNA barcode into engineered strains, which stores user-defined information to distinguish engineered bacteria from natural bacteria. This Barcode can effectively help researchers track possible escaped bacterial individuals and distinct engineered strains or natural ones in an out-of-lab environment.

To design the desired barcode, we used online tools to generate a DNA Barcode sequence to store "NDNFCHINAIGEM2021“ in the DNA sequence “CTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT”.

Since the Barcode needs to be subsequently detected by CRISPR-Cas12a based nucleic acids, we added the PAM sequence (TTTA) required for Cas12a at the 3' end of the Barcode. So the final sequence is "TTTACTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT" (Figure 1).

Figure 1: The code table for translating information into DNA barcode.

The Barcode designed here was then integrated into the E. coli Top10 genome fimA site (Figure 2).

Figure 2: The gel image of the result of genome integration of DNA barcode into fimA site (a kill switch is also integrated into the genome with DNA barcode. For more information, please visit: NDNF_China Proof-Of-Concept.)

Sequence and Features