Difference between revisions of "Part:BBa K3970019"
Line 8: | Line 8: | ||
==Construction== | ==Construction== | ||
− | [[File:19-1.png|600px|]] | + | [[File:19-1.png|600px|]] |
− | [[File:0019-2.png|600px|]] | + | [[File:0019-2.png|600px|]] |
For yeast is a kind of eukaryote, each gene need one primer and one terminator to construct the expression cassette. For cpcE and cpcF, we use primer GAP and terminator CYC1. We get the gene sequence of cpcE and cpcF from Genscript who helped us synthesized the interest sequence. The GAP promoter is originally on the plasmid pTDH3-dCAS9 and also the terminator is originally on the plasmid p426. We use related primer to cut them down and re-construct them with cpcE and cpcF. | For yeast is a kind of eukaryote, each gene need one primer and one terminator to construct the expression cassette. For cpcE and cpcF, we use primer GAP and terminator CYC1. We get the gene sequence of cpcE and cpcF from Genscript who helped us synthesized the interest sequence. The GAP promoter is originally on the plasmid pTDH3-dCAS9 and also the terminator is originally on the plasmid p426. We use related primer to cut them down and re-construct them with cpcE and cpcF. | ||
Line 16: | Line 16: | ||
Primers we use to construct cpcE and cpcF expression cassette: | Primers we use to construct cpcE and cpcF expression cassette: | ||
− | Plasmid skeleton-up (25-mer) | + | |
− | gtacccaattcgccctatagtgagt | + | Plasmid skeleton-up (25-mer): |
− | Plasmid skeleton-dn (21-mer) | + | gtacccaattcgccctatagtgagt |
+ | |||
+ | Plasmid skeleton-dn (21-mer): | ||
gctagcccaagagggcacta | gctagcccaagagggcacta | ||
+ | |||
cpcF-dn (23-mer): | cpcF-dn (23-mer): | ||
tcaggaggtcaattgggctagtg | tcaggaggtcaattgggctagtg | ||
+ | |||
cpcE-dn (20-mer): | cpcE-dn (20-mer): | ||
gaccatcaggaggtcaattg | gaccatcaggaggtcaattg | ||
+ | |||
GAP-dn (21-mer): | GAP-dn (21-mer): | ||
ggcatggtggcgagatctaat | ggcatggtggcgagatctaat | ||
+ | |||
CYC1-dn (23-mer): | CYC1-dn (23-mer): | ||
ggccgcaaattaaagccttcgag | ggccgcaaattaaagccttcgag | ||
+ | |||
GAP-cpcE-up (43-mer): | GAP-cpcE-up (43-mer): | ||
attagatctcgccaccatgccatgttgtcattagaacaattgg | attagatctcgccaccatgccatgttgtcattagaacaattgg | ||
+ | |||
cpcE-CYC1-up (40-mer): | cpcE-CYC1-up (40-mer): | ||
ttggctcaaagatgatggtccgagtcatgtaattagttat | ttggctcaaagatgatggtccgagtcatgtaattagttat | ||
+ | |||
CYC1-GAP-up (44-mer): | CYC1-GAP-up (44-mer): | ||
ctcgaaggctttaatttgcggccggagctcactcggaattcagt | ctcgaaggctttaatttgcggccggagctcactcggaattcagt | ||
+ | |||
GAP-cpcF-up (41-mer): | GAP-cpcF-up (41-mer): | ||
attagatctcgccaccatgccTattggtgttgacactacca | attagatctcgccaccatgccTattggtgttgacactacca | ||
+ | |||
cpcF-CYC1-up (43-mer): | cpcF-CYC1-up (43-mer): | ||
cactagcccaattgacctcctgacgagtcatgtaattagttat | cactagcccaattgacctcctgacgagtcatgtaattagttat | ||
+ | |||
骨架+GAP (42-mer): | 骨架+GAP (42-mer): | ||
gtagtgccctcttgggctagcggagctcactcggaattcagt | gtagtgccctcttgggctagcggagctcactcggaattcagt | ||
+ | |||
骨架+CYC1 (43-mer): | 骨架+CYC1 (43-mer): | ||
Ctcgaaggctttaatttgcggccgtacccaattcgccctatag | Ctcgaaggctttaatttgcggccgtacccaattcgccctatag | ||
+ | |||
==Experiment results== | ==Experiment results== | ||
− | [[File:0019-3.png| | + | [[File:0019-3.png|600px|]] |
− | Figure1:The fragments of the constructed plasmid were recovered | + | |
+ | Figure1:The fragments of the constructed plasmid were recovered | ||
− | M:Marker | + | M:Marker |
− | 1-4:CYC1(terminator) | + | |
+ | 1-4:CYC1(terminator) | ||
+ | |||
5-8:CpcE | 5-8:CpcE | ||
+ | |||
9:GAP (promoter) | 9:GAP (promoter) | ||
+ | |||
10-13:CpcF | 10-13:CpcF | ||
+ | |||
14-17:CpcA | 14-17:CpcA | ||
+ | |||
Revision as of 04:44, 5 October 2021
pGAP-CpcE-tCYC1-pGAP-CpcF-tCYC1
Usage and Biology
CpcE and CpcF respectively encode Phycocyanobilin lyase subunit alpha and Phycocyanobilin lyase subunit beta, these two units constitute Phycocyanobilin lyase.Phycocyanobilin lyase is required for the chromophorylation of α-phycocyanin to form holo-α-subunit.
Construction
For yeast is a kind of eukaryote, each gene need one primer and one terminator to construct the expression cassette. For cpcE and cpcF, we use primer GAP and terminator CYC1. We get the gene sequence of cpcE and cpcF from Genscript who helped us synthesized the interest sequence. The GAP promoter is originally on the plasmid pTDH3-dCAS9 and also the terminator is originally on the plasmid p426. We use related primer to cut them down and re-construct them with cpcE and cpcF. The construction procedure is that we separately synthesized expression cassette cpcE and cpcF with primer and terminator. Then we insert the two expression cassette into the plasmid pTDH3(The plsmid has been edited to delete the sequence of dCas9, which will effect the expression of our gene )
Primers we use to construct cpcE and cpcF expression cassette:
Plasmid skeleton-up (25-mer): gtacccaattcgccctatagtgagt
Plasmid skeleton-dn (21-mer): gctagcccaagagggcacta
cpcF-dn (23-mer): tcaggaggtcaattgggctagtg
cpcE-dn (20-mer): gaccatcaggaggtcaattg
GAP-dn (21-mer): ggcatggtggcgagatctaat
CYC1-dn (23-mer): ggccgcaaattaaagccttcgag
GAP-cpcE-up (43-mer): attagatctcgccaccatgccatgttgtcattagaacaattgg
cpcE-CYC1-up (40-mer): ttggctcaaagatgatggtccgagtcatgtaattagttat
CYC1-GAP-up (44-mer): ctcgaaggctttaatttgcggccggagctcactcggaattcagt
GAP-cpcF-up (41-mer): attagatctcgccaccatgccTattggtgttgacactacca
cpcF-CYC1-up (43-mer): cactagcccaattgacctcctgacgagtcatgtaattagttat
骨架+GAP (42-mer): gtagtgccctcttgggctagcggagctcactcggaattcagt
骨架+CYC1 (43-mer): Ctcgaaggctttaatttgcggccgtacccaattcgccctatag
Experiment results
Figure1:The fragments of the constructed plasmid were recovered
M:Marker
1-4:CYC1(terminator)
5-8:CpcE
9:GAP (promoter)
10-13:CpcF
14-17:CpcA
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]