Difference between revisions of "Part:BBa K3726094"

Revision as of 10:46, 6 October 2021

T(5a)_Teck

This part corresponds with the rho-independent terminator of synechococcus utex 2973 in different growth conditions.

Sequence & Features

Assembly Compatibility:

ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

@@ Line 2: / Line 2: @@
 <partinfo>Bba_K3726094 short</partinfo>
-The part is marburg collection designMoClo Lv.0 part, assembled in the universal phytobrick entry vector BBa_K2560001. The upstream overhang is GCTTAA where AA are extra bases for creating an additional stop codon (TAA) in the end of the upstream coding sequence in accordance with the Marburg Collection design guidelines.
+This part corresponds with the rho-independent terminator of synechococcus utex 2973 in different growth conditions.
-This terminator part spans the 5A position of the MoClo syntax. The downstream overhang is GGTA, allowing the assembly of an additional expression cassette downstream the terminator part.
-This “5A” position terminator allows the introduction of an additional selection marker coupled to the transcriptional unit assembled during level 1 MoClo reaction. They are used for the creation of integrative genetic devices using Homology Connectors. To know more about, read the design principles of Marburg Collection. (Referencia a Marburg).