Difference between revisions of "Part:BBa K165037:Design"
Line 28: Line 28:
  
 
TEF.rev:  cggtcaacgaactataattaacta + tactagtagcggccgctgcag + AAGAAAC
 
TEF.rev:  cggtcaacgaactataattaacta + tactagtagcggccgctgcag + AAGAAAC
 +
 +
 +
To do whole-cell PCR, we prepared a reaction with double the normal magnesium and no template
 +
 +
10 ul 5x PCR buffer
 +
6 uL 25 mM MgCl2
 +
1 ul 20 uM TEF.fwd primer
 +
1 ul 20 uM TEF.rev primer
 +
1 ul 10 mM (each) dNTP mix
 +
.25 ul  Taq polymerase
 +
31.75 ul cartridge-purified water
 +
 +
We took a small spot of cells off of a fresh plate of W303a with a 200uL pipette tip, and ground them against the bottom of the reaction tube with the tip.  This is not the time to be dainty- the idea is to break open the cells with physical force.
 +
 +
We ran the reaction with the following program:
 +
95C- 5 min
 +
30 cycles of-[
 +
95C- 30s
 +
45C- 60s
 +
68C- 2 min
 +
]
 +
68C- 5min
 +
 +
We got a faint nonspecific product that was longer than the expected product, so gel extracted the expected product before ligating onto pSB1AK3.
 +
 +
  
 
===References===
 
===References===

Revision as of 19:27, 2 November 2008

TEF2 yeast constitutive promoter


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

-


Source

Amplified from the yeast genome (strain W303a) by Brown iGEM using promoter definition from:

Mumberg, Muller, and Funk: http://dx.doi.org/10.1016/0378-1119(95)00037-7


Here are the primers we used:

example: spacer + biobrick prefeix + homologous to yeast genome

TEF.fwd: GTTTCTT + attacccataaggttgtttgtgacgg + agcgttggttggtggatcaag

example: homologous to yeast genome + biobrick suffix + spacer

TEF.rev: cggtcaacgaactataattaacta + tactagtagcggccgctgcag + AAGAAAC


To do whole-cell PCR, we prepared a reaction with double the normal magnesium and no template

10 ul 5x PCR buffer 6 uL 25 mM MgCl2 1 ul 20 uM TEF.fwd primer 1 ul 20 uM TEF.rev primer 1 ul 10 mM (each) dNTP mix .25 ul Taq polymerase 31.75 ul cartridge-purified water

We took a small spot of cells off of a fresh plate of W303a with a 200uL pipette tip, and ground them against the bottom of the reaction tube with the tip. This is not the time to be dainty- the idea is to break open the cells with physical force.

We ran the reaction with the following program: 95C- 5 min 30 cycles of-[ 95C- 30s 45C- 60s 68C- 2 min ] 68C- 5min

We got a faint nonspecific product that was longer than the expected product, so gel extracted the expected product before ligating onto pSB1AK3.


References