Difference between revisions of "Collections/BIOFAB"

Line 56: Line 56:
 
       </tr>
 
       </tr>
 
   </table>
 
   </table>
 +
 +
  <html>
 +
    <canvas id="myChart" width="400" height="400"></canvas>
 +
<script>
 +
var ctx = document.getElementById('myChart').getContext('2d');
 +
var myChart = new Chart(ctx, {
 +
    type: 'bar',
 +
    data: {
 +
        labels: ['Red', 'Blue', 'Yellow', 'Green', 'Purple', 'Orange'],
 +
        datasets: [{
 +
            label: '# of Votes',
 +
            data: [12, 19, 3, 5, 2, 3],
 +
            backgroundColor: [
 +
                'rgba(255, 99, 132, 0.2)',
 +
                'rgba(54, 162, 235, 0.2)',
 +
                'rgba(255, 206, 86, 0.2)',
 +
                'rgba(75, 192, 192, 0.2)',
 +
                'rgba(153, 102, 255, 0.2)',
 +
                'rgba(255, 159, 64, 0.2)'
 +
            ],
 +
            borderColor: [
 +
                'rgba(255, 99, 132, 1)',
 +
                'rgba(54, 162, 235, 1)',
 +
                'rgba(255, 206, 86, 1)',
 +
                'rgba(75, 192, 192, 1)',
 +
                'rgba(153, 102, 255, 1)',
 +
                'rgba(255, 159, 64, 1)'
 +
            ],
 +
            borderWidth: 1
 +
        }]
 +
    },
 +
    options: {
 +
        scales: {
 +
            y: {
 +
                beginAtZero: true
 +
            }
 +
        }
 +
    }
 +
});
 +
</script>
 +
  </html>
  
 
<table id="" class="" cellspacing="0" cellpadding="3" style="">
 
<table id="" class="" cellspacing="0" cellpadding="3" style="">

Revision as of 14:32, 21 August 2021

This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.

This collection is undergoing curation by the 2021 FSU iGEM team...

How is the BIOFAB collection useful to you?

The BIOFAB collection contains over 250 promoters that are registered BioBricks parts. The promoters have a range of relative expression that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on desired expression levels. This allows the promoter strength to be varied when designing genetic constructs by selecting a promoter with a different relative strength. The BIOFAB promoters do not always display the expected expression strength. The observed expression strength is thought to vary depending on the genetic context. To ensure that a promoter with the desired strength is selected, the design should be tested with several different promoters of similar strengths. Using multiple promoters increases the likelihood that at least one promoter will display the desired strength.

How does it work?

The promoters on this page are listed in order of decreasing strength. The strongest promoters produce the most RNA transcripts of their downstream gene, while the weakest promoters produce the fewest RNA transcripts. The promoter strength is determined by how strongly the DNA sequence recruits RNA polymerase. Stronger promoters are better able to recruit RNA polymerase, so they cause transcription to occur more frequently. Weaker promoters cannot recruit RNA polymerase as effectively, so they cause transcription to occur less frequently.

How was it built?

The 2018 FSU iGEM team measured the expression levels of three BIOFAB promoters in iGEM plasmids. A test device was created, which contained a BIOFAB promoter, a ribosome binding site (part B0034), a red fluorescent protein (part mRFP1 E1010), and a double terminator(part B0015). (make the names of these parts hyperlinks to their webpages) The test device was incorporated into the plasmid pSB1C3, which gives transformed bacteria resistance to chloramphenicol.

[plasmid map]

The test device was created by combining the pSB1C3 backbone with two overlapping DNA inserts. The first insert contained the biobrick prefix, the BIOFAB promoter, and part of the mRFP1 gene. The second insert contained the full mRFP1 gene, the double terminator, and the biobrick suffix. The three DNA sequences were then combined into one plasmid using the NEB Hifi DNA Assembly Master Mix protocol. This procedure combines multiple pieces of DNA that share overlapping sequences into a single DNA molecule. The partial mRFP1 sequence on the first insert overlaps with the full mRFP1 gene on the second insert, so the Hifi Assembly method combines the two inserts into a single DNA oligo. The combined insert begins with a biobrick prefix and ends with a biobrick suffix, which overlap with the prefix and suffix that are found on the plasmid. Once the insert is assembled into the plasmid, the final plasmid is complete.

Libraries

Modular Promoter Library


apFAB46 897.6iGEM Part: BBa_M36303
apFAB70 866.7iGEM Part: BBa_K2832101
apFAB71 866.3iGEM Part: BBa_K2832102
 
     

  
     </tr>
iGEM Registry Name BIOFAB ID Strength (mean fluorescence per cell)
BBa_K2832103 apFAB61 857.927
BBa_K2832104 apFAB80 787.199
BBa_K2832105 apFAB45 785.309
BBa_K2832106 apFAB47 782.004
BBa_K2832107 apFAB31 781.826
BBa_K2832108 apFAB55 768.983
BBa_K2832109 apFAB68 766.301
BBa_K2832110 apFAB101 757.959
BBa_K2832111 apFAB96 748.822
BBa_K2832112 apFAB56 743.476
BBa_K2832113 apFAB81 742.631
BBa_K2832114 apFAB92 742.334
BBa_K2832115 apFAB72 737.59
BBa_K2832116 apFAB100 736.966
BBa_K2832117 apFAB76 736.51
BBa_K2832118 apFAB30 731.463
BBa_K2832119 apFAB79 728.654
BBa_K2832120 apFAB75 717.72
BBa_K2832121 apFAB50 707.166
BBa_K2832122 apFAB93 706.957
BBa_K2832123 apFAB60 700.31
BBa_K2832124 apFAB54 690.839
BBa_K2832125 apFAB62 687.948
BBa_K2832126 apFAB42 685.34
BBa_K2832127 apFAB53 682.888
BBa_K2832128 apFAB85 674.421
BBa_K2832129 apFAB65 670.065
BBa_K2832130 apFAB52 666.998
BBa_K2832131 apFAB67 649.993
BBa_K2832132 apFAB32 645.519
BBa_K2832133 apFAB57 637.488
BBa_K2832134 apFAB39 594.378
BBa_K2832135 apFAB115 573.792
BBa_K2832136 apFAB29 565.946
BBa_K2832137 apFAB77 555.565
BBa_K2832138 apFAB36 547.956
BBa_K2832139 apFAB44 540.856
BBa_K2832140 apFAB102 534.826
BBa_K2832141 apFAB37 530.604
BBa_K2832142 apFAB41 523.35
BBa_K2832143 apFAB63 518.502
BBa_K2832144 apFAB140 508.942
BBa_K2832145 apFAB64 508.117
BBa_K2832146 apFAB40 488.364
BBa_K2832147 apFAB97 477.744
BBa_K2832148 apFAB78 476.327
BBa_K2832149 apFAB69 474.513
BBa_K2832150 apFAB103 459.253
BBa_K2832151 apFAB73 456.758
BBa_K2832152 apFAB66 439.276
BBa_K2832153 apFAB126 433.829
BBa_K2832154 apFAB95 425.407
BBa_K2832155 apFAB151 422.838
BBa_K2832156 apFAB48 411.861
BBa_K2832157 apFAB82 389.529
BBa_K2832158 apFAB141 376.932
BBa_K2832159 apFAB150 366.498
BBa_K2832160 apFAB125 363.199
BBa_K2832161 apFAB33 340.476
BBa_K2832162 apFAB121 328.946
BBa_K2832163 apFAB111 327.288
BBa_K2832164 apFAB58 287.687
BBa_K2832165 apFAB94 279.605
BBa_K2832166 apFAB145 271.14
BBa_K2832167 apFAB118 267.819
BBa_K2832168 apFAB106 256.824
BBa_K2832169 apFAB110 254.676
BBa_K2832170 apFAB105 243.758
BBa_K2832171 apFAB38 239.875
BBa_K2832172 apFAB89 223.766
BBa_K2832173 apFAB142 214.923
BBa_K2832174 apFAB130 182.202
BBa_K2832175 apFAB131 167.803
BBa_K2832176 apFAB143 157.015
BBa_K2832177 apFAB87 145.215
BBa_K2832178 apFAB104 126.832
BBa_K2832179 apFAB98 120.521
BBa_K2832180 apFAB51 103.187
BBa_K2832181 apFAB49 93.9231
BBa_K2832182 apFAB120 81.7515
BBa_K2832183 apFAB83 79.3039
BBa_K2832184 apFAB117 62.9585
BBa_K2832185 apFAB129 60.7537
BBa_K2832186 apFAB146 58.9582
BBa_K2832187 apFAB59 58.498
BBa_K2832188 apFAB127 48.3838
BBa_K2832189 apFAB88 48.354
BBa_K2832190 apFAB86 44.6204
BBa_K2832191 apFAB74 44.6094
BBa_K2832192 apFAB152 40.7219
BBa_K2832193 apFAB122 36.8209
BBa_K2832194 apFAB128 26.6541
BBa_K2832195 apFAB99 26.5471
BBa_K2832196 apFAB119 20.866
BBa_K2832197 apFAB112 17.3114
BBa_K2832198 apFAB34 14.6339
BBa_K2832199 apFAB147 13.3236
BBa_K2832200 apFAB144 13.0792
BBa_K2832201 apFAB35 12.6234
BBa_K2832202 apFAB107 11.4242
BBa_K2832203 apFAB123 11.2076
BBa_K2832204 apFAB137 7.09512
BBa_K2832205 apFAB113 5.32229
BBa_K2832206 apFAB84 4.73181
BBa_K2832207 apFAB148 4.01421
BBa_K2832208 apFAB108 3.64128
BBa_K2832209 apFAB114 3.35398
BBa_K2832210 apFAB136 3.19915
BBa_K2832211 apFAB124 2.64681
BBa_K2832212 apFAB149 2.52982
BBa_K2832213 apFAB134 2.52663
BBa_K2832214 apFAB138 1.64153
BBa_K2832215 apFAB43 1.0947
BBa_K2832216 apFAB133 0.84608
BBa_K2832217 apFAB139 0.681873
BBa_K2832218 apFAB91 0.42395
BBa_K2832219 apFAB90 0.378777

Randomized Promoter Library

Parts Registry Name BIOFAB ID Strength (mean fluorescence per cell)
BBa_J97008 apFAB342 740.35
BBa_K3702000 apFAB347 738.40
BBa_K3702001 apFAB345 714.53
BBa_K3702002 apFAB341 668.45
BBa_K3702003 apFAB317 654.56
BBa_K3702004 apFAB338 615.44
BBa_K3702005 apFAB323 611.20
BBa_K3702006 apFAB339 580.23
BBa_K3702007 apFAB321 557.04
BBa_K3702008 apFAB340 538.51
BBa_K3702009 apFAB322 516.83
BBa_K3702010 apFAB346 466.88
BBa_K3702011 apFAB303 345.31
BBa_K3702012 apFAB302 342.55
BBa_K3702013 apFAB297 339.75
BBa_K3702014 apFAB301 338.31
BBa_K3702015 apFAB298 327.52
BBa_K3702016 apFAB306 307.03
BBa_K3702017 apFAB307 283.99
BBa_K3702018 apFAB296 277.56
BBa_K3702019 apFAB308 269.83
BBa_K3702020 apFAB295 252.47
BBa_K3702021 apFAB300 246.62
BBa_K3702022 apFAB299 203.95
BBa_K3702023 apFAB309 199.95
BBa_K3702024 apFAB305 164.05
BBa_K3702025 apFAB313 160.29
BBa_K3702026 apFAB310 156.73
BBa_K3702027 apFAB311 155.52
BBa_K3702028 apFAB279 145.82
BBa_K3702029 apFAB314 141.99
BBa_K3702030 apFAB281 139.88
BBa_K3702031 apFAB276 138.28
BBa_K3702032 apFAB312 135.53
BBa_K3702033 apFAB273 128.84
BBa_K3702034 apFAB316 123.38
BBa_K3702035 apFAB282 105.12
BBa_K3702036 apFAB260 99.29
BBa_K3702037 apFAB293 98.98
BBa_K3702038 apFAB259 95.97
BBa_K3702039 apFAB284 77.82
BBa_K3702040 apFAB285 76.92
BBa_K3702041 apFAB286 76.12
BBa_K3702042 apFAB257 75.39
BBa_K3702043 apFAB267 74.39
BBa_K3702044 apFAB263 70.05
BBa_K3702045 apFAB262 65.83
BBa_K3702046 apFAB265 63.55
BBa_K3702047 apFAB271 59.33
BBa_K3702048 apFAB278 58.41
BBa_K3702049 apFAB241 57.40
BBa_K3702050 apFAB280 57.40
BBa_K3702051 apFAB254 57.29
BBa_K3702052 apFAB266 56.78
BBa_K3702053 apFAB270 55.67
BBa_K3702054 apFAB287 52.53
BBa_K3702055 apFAB256 49.71
BBa_K3702056 apFAB253 49.10
BBa_K3702057 apFAB264 48.80
BBa_K3702058 apFAB337 48.57
BBa_K3702059 apFAB261 47.13
BBa_K3702060 apFAB272 45.89
BBa_K3702061 apFAB274 44.90
BBa_K3702062 apFAB258 39.55
BBa_K3702063 apFAB255 38.32
BBa_K3702064 apFAB268 38.05
BBa_K3702065 apFAB333 34.24
BBa_K3702066 apFAB326 33.51
BBa_K3702067 apFAB343 33.50
BBa_K3702068 apFAB329 33.21
BBa_K3702069 apFAB332 32.73
BBa_K3702070 apFAB252 32.49
BBa_K3702071 apFAB251 30.07
BBa_K3702072 apFAB226 29.25
BBa_K3702073 apFAB315 25.64
BBa_K3702074 apFAB335 21.55
BBa_K3702075 apFAB334 21.08
BBa_K3702076 apFAB319 20.39
BBa_K3702077 apFAB229 15.31
BBa_K3702078 apFAB228 14.36
BBa_K3702079 apFAB225 13.71
BBa_K3702080 apFAB224 13.10
BBa_K3702081 apFAB324 12.77
BBa_K3702082 apFAB230 12.69
BBa_K3702083 apFAB318 12.62
BBa_K3702084 apFAB331 11.14
BBa_K3702085 apFAB304 10.75
BBa_K3702086 apFAB231 10.58
BBa_K3702087 apFAB227 9.46
BBa_K3702088 apFAB209 8.05
BBa_K3702089 apFAB202 5.83
BBa_K3702090 apFAB212 5.57
BBa_K3702091 apFAB211 5.30
BBa_K3702092 apFAB221 4.87
BBa_K3702093 apFAB205 4.80
BBa_K3702094 apFAB201 4.75
BBa_K3702095 apFAB193 4.48
BBa_K3702096 apFAB203 4.46
BBa_K3702097 apFAB200 4.41
BBa_K3702098 apFAB207 4.26
BBa_K3702099 apFAB206 4.20
BBa_K3702100 apFAB194 4.17
BBa_K3702101 apFAB208 4.17
BBa_K3702102 apFAB181 4.00
BBa_K3702103 apFAB204 3.85
BBa_K3702104 apFAB190 3.75
BBa_K3702105 apFAB189 3.69
BBa_K3702106 apFAB184 3.62
BBa_K3702107 apFAB215 3.44
BBa_K3702108 apFAB168 3.33
BBa_K3702109 apFAB197 3.28
BBa_K3702110 apFAB199 3.27
BBa_K3702111 apFAB216 3.09
BBa_K3702112 apFAB180 2.98
BBa_K3702113 apFAB187 2.97
BBa_K3702114 apFAB182 2.94
BBa_K3702115 apFAB186 2.92
BBa_K3702116 apFAB183 2.76
BBa_K3702117 apFAB195 2.73
BBa_K3702118 apFAB167 2.68
BBa_K3702119 apFAB177 2.67
BBa_K3702120 apFAB192 2.57
BBa_K3702121 apFAB220 2.55
BBa_K3702122 apFAB161 2.54
BBa_K3702123 apFAB160 2.52
BBa_K3702124 apFAB162 2.51
BBa_K3702125 apFAB159 2.50
BBa_K3702126 apFAB164 2.50
BBa_K3702127 apFAB166 2.49
BBa_K3702128 apFAB157 2.48
BBa_K3702129 apFAB217 2.48
BBa_K3702130 apFAB156 2.46
BBa_K3702131 apFAB213 2.33
BBa_K3702132 apFAB325 2.24
BBa_K3702133 apFAB188 1.93
BBa_K3702134 apFAB210 1.80
BBa_K3702135 apFAB327 0.75
BBa_K3702136 apFAB294 0.21

Terminator Library

iGEM Registry Name BIOFAB ID Termination Efficiency
BBa_K3702137 apFAB352
BBa_K3702138 apFAB353
BBa_K3702139 apFAB354
BBa_K3702140 apFAB355
BBa_K3702141 apFAB356
BBa_K3702142 apFAB357
BBa_K3702143 apFAB358
BBa_K3702144 apFAB359
BBa_K3702145 apFAB360
BBa_K3702146 apFAB361
BBa_K3702147 apFAB362
BBa_K3702148 apFAB363
BBa_K3702149 apFAB364
BBa_K3702150 apFAB365
BBa_K3702151 apFAB366
BBa_K3702152 apFAB367
BBa_K3702153 apFAB368
BBa_K3702154 apFAB369
BBa_K3702155 apFAB370
BBa_K3702156 apFAB371
BBa_K3702157 apFAB372
BBa_K3702158 apFAB373
BBa_K3702159 apFAB374
BBa_K3702160 apFAB375
BBa_K3702161 apFAB376
BBa_K3702162 apFAB377
BBa_K3702163 apFAB378
BBa_K3702164 apFAB379
BBa_K3702165 apFAB380
BBa_K3702166 apFAB381
BBa_K3702167 apFAB382
BBa_K3702168 apFAB383
BBa_K3702169 apFAB384
BBa_K3702170 apFAB385
BBa_K3702171 apFAB386
BBa_K3702172 apFAB387
BBa_K3702173 apFAB388
BBa_K3702174 apFAB389
BBa_K3702175 apFAB390
BBa_K3702176 apFAB391

References

Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404

The data visualization is provided by the Charts.css library. You can use the Charts.css 0.9.0 library in your wiki page by adding the FSU/ChartsCSS template to the page.

Tables Generated by the Parts Registry

Modular Promoters Table


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2832100BIOFAB Modular Promoter apFAB46RegulatoryBIOFAB471 . . . cgcatctttttgtacctataatagattcat
BBa_K2832101BIOFAB Modular Promoter apFAB70RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832102BIOFAB Modular Promoter apFAB71RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatagattcat
BBa_K2832103BIOFAB Modular Promoter apFAB61RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832104BIOFAB Modular Promoter apFAB80RegulatoryBIOFAB49  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832105BIOFAB Modular Promoter apFAB45RegulatoryBIOFAB47  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832106BIOFAB Modular Promoter apFAB47RegulatoryBIOFAB47  . . . cgcatctttttgtacccataattatttcat
BBa_K2832107BIOFAB modular Promoter apFAB31RegulatoryBIOFAB48  . . . aagtctaacctataggtataatagattcat
BBa_K2832108BIOFAB modular Promoter apFAB55RegulatoryBIOFAB38  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832109BIOFAB modular Promoter apFAB68RegulatoryBIOFAB37  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832110BIOFAB modular Promoter apFAB101RegulatoryBIOFAB48  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832111BIOFAB Modular Promoter apFAB96RegulatoryBIOFAB48  . . . cgcatctttttgtacctataatagattcat
BBa_K2832112BIOFAB Modular Promoter apFAB56RegulatoryBIOFAB38  . . . aagtctaacctataggtataatagattcat
BBa_K2832113BIOFAB Modular Promoter apFAB81RegulatoryBIOFAB49  . . . aagtctaacctataggtataatagattcat
BBa_K2832114BIOFAB Modular Promoter apFAB92RegulatoryBIOFAB48  . . . caggaaaatttttctgcataattatttcat
BBa_K2832115BIOFAB Modular Promoter apFAB72RegulatoryBIOFAB37  . . . cgcatctttttgtacccataattatttcat
BBa_K2832116BIOFAB Modular Promoter apFAB100RegulatoryBIOFAB48  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832117BIOFAB Modular Promoter apFAB76RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832118BIOFAB Modular Promoter apFAB30RegulatoryBIOFAB48  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832119BIOFAB Modular Promoter apFAB79RegulatoryBIOFAB49  . . . aagtctaacctataggatacttacagccat
BBa_K2832120BIOFAB Modular Promoter apFAB75RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832121BIOFAB Modular Promoter apFAB50RegulatoryBIOFAB47  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832122BIOFAB Modular Promoter apFAB93RegulatoryBIOFAB48  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832123BIOFAB Modular Promoter apFAB60RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832124BIOFAB Modular Promoter apFAB54RegulatoryBIOFAB38  . . . aagtctaacctataggatacttacagccat
BBa_K2832125BIOFAB Modular Promoter apFAB62RegulatoryBIOFAB37  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832126BIOFAB Modular Promoter apFAB42RegulatoryBIOFAB47  . . . caggaaaatttttctgcataattatttcat
BBa_K2832127BIOFAB Modular Promoter apFAB53RegulatoryBIOFAB47  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832128BIOFAB Modular Promoter apFAB85RegulatoryBIOFAB48  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832129BIOFAB Modular Promoter apFAB65RegulatoryBIOFAB37  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832130BIOFAB Modular Promoter apFAB52RegulatoryBIOFAB47  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832131BIOFAB Modular Promoter apFAB67RegulatoryBIOFAB37  . . . caggaaaatttttctgcataattatttcat
BBa_K2832132BIOFAB Modular Promoter apFAB32RegulatoryBIOFAB48  . . . aagtctaacctataggcataattatttcat
BBa_K2832133BIOFAB Modular Promoter apFAB57RegulatoryBIOFAB38  . . . aagtctaacctataggcataattatttcat
BBa_K2832134BIOFAB Modular Promoter apFAB39RegulatoryBIOFAB47  . . . caggaaaatttttctgatacttacagccat
BBa_K2832135BIOFAB Modular Promoter apFAB115RegulatoryBIOFAB37  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832136BIOFAB Modular Promoter apFAB29RegulatoryBIOFAB48  . . . aagtctaacctataggatacttacagccat
BBa_K2832137BIOFAB Modular Promoter apFAB77RegulatoryBIOFAB37  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832138BIOFAB Modular Promoter apFAB36RegulatoryBIOFAB47  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832139BIOFAB Modular Promoter apFAB44RegulatoryBIOFAB47  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832140BIOFAB Modular Promoter apFAB102RegulatoryBIOFAB48  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832141BIOFAB Modular Promoter apFAB37RegulatoryBIOFAB47  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832142BIOFAB Modular Promoter apFAB41RegulatoryBIOFAB47  . . . caggaaaatttttctgtataatagattcat
BBa_K2832143BIOFAB Modular Promoter apFAB63RegulatoryBIOFAB37  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832144BIOFAB Modular Promoter apFAB140RegulatoryBIOFAB45  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832145bIOFAB Modular Promoter apFAB64RegulatoryBIOFAB37  . . . caggaaaatttttctgatacttacagccat
BBa_K2832146BIOFAB Modular Promoter apFAB40RegulatoryBIOFAB47  . . . caggaaaatttttctgtataatgtgtggat
BBa_K2832147BIOFAB Modular Promoter apFAB97RegulatoryBIOFAB48  . . . cgcatctttttgtacccataattatttcat
BBa_K2832148BIOFAB modular Promoter apFAB78RegulatoryBIOFAB37  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832149BIOFAB Modular Promoter apFAB69RegulatoryBIOFAB37  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832150BIOFAB Modular Promoter apFAB103RegulatoryBIOFAB48  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832151BIOFAB Modular Promoter apFAB73RegulatoryBIOFAB37  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832152BIOFAB Modular Promoter apFAB66RegulatoryBIOFAB37  . . . caggaaaatttttctgtataatagattcat
BBa_K2832153BIOFAB Modular Promoter apFAB126RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832154BIOFAB Modular Promoter apFAB95RegulatoryBIOFAB48  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832155BIOFAB Modular Promoter apFAB151RegulatoryBIOFAB45  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832156BIOFAB Modular Promoter apFAB48RegulatoryBIOFAB47  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832157BIOFAB Modular Promoter apFAB82RegulatoryBIOFAB491 . . . aagtctaacctataggcataattatttcat
BBa_K2832158BIOFAB Modular Promoter apFAB141RegulatoryBIOFAB45  . . . caggaaaatttttctgtataatagattcat
BBa_K2832159BIOFAB Modular Promoter apFAB150RegulatoryBIOFAB45  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832160BIOFAB Modular Promoter apFAB125RegulatoryBIOFAB37  . . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832161BIOFAB Modular Promoter apFAB33RegulatoryBIOFAB48  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832162BIOFAB Modular Promoter apFAB121RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatagattcat
BBa_K2832163BIOFAB modular Promoter apFAB111RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832164BIOFAB modular Promoter apFAB58RegulatoryBIOFAB38  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832165BIOFAB modular Promoter apFAB94RegulatoryBIOFAB48  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832166BIOFAB modular Promoter apFAB145RegulatoryBIOFAB45  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832167BIOFAB Modular Promoter apFAB118RegulatoryBIOFAB37  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832168BIOFAB Modular Promoter apFAB106RegulatoryBIOFAB38  . . . aagtctaacctataggtataatagattcat
BBa_K2832169BIOFAB Modular Promoter apFAB110RegulatoryBIOFAB37  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832170BIOFAB Modular Promoter apFAB105RegulatoryBIOFAB38  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832171BIOFAB Modular Promoter apFAB38RegulatoryBIOFAB47  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832172BIOFAB Modular Promoter apFAB89RegulatoryBIOFAB48  . . . caggaaaatttttctgatacttacagccat
BBa_K2832173BIOFAB Modular Promoter apFAB142RegulatoryBIOFAB45  . . . caggaaaatttttctgcataattatttcat
BBa_K2832174BIOFAB Modular Promoter apFAB130RegulatoryBIOFAB46  . . . aagtctaacctataggtataatgtgtggat
BBa_K2832175BIOFAB Modular Promoter apFAB131RegulatoryBIOFAB46  . . . aagtctaacctataggtataatagattcat
BBa_K2832176BIOFAB Modular Promoter apFAB143RegulatoryBIOFAB45  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832177BIOFAB Modular Promoter apFAB87RegulatoryBIOFAB48  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832178BIOFAB Modular Promoter apFAB104RegulatoryBIOFAB38  . . . aagtctaacctataggatacttacagccat
BBa_K2832179BIOFAB Modular Promoter apFAB98RegulatoryBIOFAB48  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832180BIOFAB Modular Promoter apFAB51RegulatoryBIOFAB47  . . . ttatcccttgcggcgatataatagattcat
BBa_K2832181BIOFAB Modular Promoter apFAB49RegulatoryBIOFAB47  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832182BIOFAB Modular Promoter apFAB120RegulatoryBIOFAB37  . . . cgcatctttttgtacctataatgtgtggat
BBa_K2832183BIOFAB Modular Promoter apFAB83RegulatoryBIOFAB49  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832184BIOFAB Modular Promoter apFAB117RegulatoryBIOFAB37  . . . caggaaaatttttctgcataattatttcat
BBa_K2832185BIOFAB Modular Promoter apFAB129RegulatoryBIOFAB46  . . . aagtctaacctataggatacttacagccat
BBa_K2832186BIOFAB Modular Promoter apFAB146RegulatoryBIOFAB45  . . . cgcatctttttgtacctataatagattcat
BBa_K2832187BIOFAB Modular Promoter apFAB59RegulatoryBIOFAB37  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832188BIOFAB Modular Promoter apFAB127RegulatoryBIOFAB37  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832189BIOFAB Modular Promoter apFAB88RegulatoryBIOFAB48  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832190BIOFAB Modular Promoter apFAB86RegulatoryBIOFAB48  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832191BIOFAB Modular Promoter apFAB74RegulatoryBIOFAB37  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832192BIOFAB Modular Promoter apFAB152RegulatoryBIOFAB45  . . . ttatcccttgcggcgacataattatttcat
BBa_K2832193BIOFAB Modular Promoter apFAB122RegulatoryBIOFAB37  . . . cgcatctttttgtacccataattatttcat
BBa_K2832194BIOFAB Modular Promoter apFAB128RegulatoryBIOFAB37  . . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832195BIOFAB Modular Promoter apFAB99RegulatoryBIOFAB48  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832196BIOFAB Modular Promoter apFAB119RegulatoryBIOFAB37  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832197BIOFAB Modular Promoter apFAB112RegulatoryBIOFAB37  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832198BIOFAB Modular Promoter apFAB34RegulatoryBIOFAB47  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832199BIOFAB Modular Promoter apFAB147RegulatoryBIOFAB45  . . . cgcatctttttgtacccataattatttcat
BBa_K2832200BIOFAB Modular Promoter apFAB144RegulatoryBIOFAB45  . . . cgcatctttttgtaccatacttacagccat
BBa_K2832201BIOFAB Modular Promoter apFAB35RegulatoryBIOFAB47  . . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832202BIOFAB modular Promoter apFAB107RegulatoryBIOFAB38  . . . aagtctaacctataggcataattatttcat
BBa_K2832203BIOFAB modular Promoter apFAB123RegulatoryBIOFAB37  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832204BIOFAB Modular Promoter apFAB137RegulatoryBIOFAB45  . . . ttaatcatccggctcgcataattatttcat
BBa_K2832205BIOFAB Modular Promoter apFAB113RegulatoryBIOFAB37  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832206BIOFAB Modular Promoter apFAB84RegulatoryBIOFAB48  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832207BIOFAB Modular Promoter apFAB148RegulatoryBIOFAB45  . . . cgcatctttttgtacctagatttaacgtat
BBa_K2832208BIOFAB Modular Promoter apFAB108RegulatoryBIOFAB38  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832209BIOFAB Modular Promoter apFAB114RegulatoryBIOFAB37  . . . caggaaaatttttctgatacttacagccat
BBa_K2832210BIOFAB Modular Promoter apFAB136RegulatoryBIOFAB45  . . . ttaatcatccggctcgtataatagattcat
BBa_K2832211BIOFAB Modular Promoter apFAB124RegulatoryBIOFAB37  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832212BIOFAB Modular Promoter apFAB149RegulatoryBIOFAB45  . . . ttatcccttgcggcgaatacttacagccat
BBa_K2832213BIOFAB Modular Promoter apFAB134RegulatoryBIOFAB45  . . . ttaatcatccggctcgatacttacagccat
BBa_K2832214BIOFAB Modular Promoter apFAB138RegulatoryBIOFAB45  . . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832215BIOFAB Modular Promoter apFAB43RegulatoryBIOFAB47  . . . caggaaaatttttctgtagatttaacgtat
BBa_K2832216BIOFAB Modular Promoter apFAB133RegulatoryBIOFAB46  . . . aagtctaacctataggtagatttaacgtat
BBa_K2832217BIOFAB Modular Promoter apFAB139RegulatoryBIOFAB45  . . . caggaaaatttttctgatacttacagccat
BBa_K2832218BIOFAB Modular Promoter apFAB91RegulatoryBIOFAB48  . . . caggaaaatttttctgtataatagattcat
BBa_K2832219BIOFAB Modular Promoter apFAB90RegulatoryBIOFAB481 . . . caggaaaatttttctgtataatgtgtggat

Randomized Promoters Table


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_J97008BIOFAB Random Promoter apFAB342RegulatoryBIOFAB36-1 . . . attaatcatccggctcataaaatttgtgga
BBa_K3702000BIOFAB Random Promoter apFAB347RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaatatgtgtgga
BBa_K3702001BIOFAB Random Promoter apFAB345RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagagtatgtgga
BBa_K3702002BIOFAB Random Promoter apFAB341RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaatatgtgtgga
BBa_K3702003BIOFAB Random Promoter apFAB317RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702004BIOFAB Random Promoter apFAB338RegulatoryBIOFAB36-1 . . . attaatcatccggctcctaggatgtgtgga
BBa_K3702005BIOFAB Random Promoter apFAB323RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702006BIOFAB Random Promoter apFAB339RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaatttatgtgga
BBa_K3702007BIOFAB Random Promoter apFAB321RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaacttatgtgga
BBa_K3702008BIOFAB Random Promoter apFAB340RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtatgtgtgga
BBa_K3702009BIOFAB Random Promoter apFAB322RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702010BIOFAB Random Promoter apFAB346RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaatgtttgtgga
BBa_K3702011BIOFAB Random Promoter apFAB303RegulatoryBIOFAB35-1 . . . tcttaatcatcggctcgtataatgtgtgga
BBa_K3702012BIOFAB Random Promoter apFAB302RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702013BIOFAB Random Promoter apFAB297RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702014BIOFAB Random Promoter apFAB301RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702015BIOFAB Random Promoter apFAB298RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702016BIOFAB Random Promoter apFAB306RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtgtttgtgga
BBa_K3702017BIOFAB Random Promoter apFAB307RegulatoryBIOFAB36-1 . . . attaatcatccggctcatatcgtttgtgga
BBa_K3702018BIOFAB Random Promoter apFAB296RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702019BIOFAB Random Promoter apFAB308RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaggttatgtgga
BBa_K3702020BIOFAB Random Promoter apFAB295RegulatoryBIOFAB35-1 . . . tcttaatcatcggctcgtataatgtgtgga
BBa_K3702021BIOFAB Random Promoter apFAB300RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702022BIOFAB Random Promoter apFAB299RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702023BIOFAB Random Promoter apFAB309RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtgtctgtgga
BBa_K3702024BIOFAB Random Promoter apFAB305RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagggtttgtgga
BBa_K3702025BIOFAB Random Promoter apFAB313RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagggtgtgtgga
BBa_K3702026BIOFAB Random Promoter apFAB310RegulatoryBIOFAB36-1 . . . attaatcatccggctcctatcttctgtgga
BBa_K3702027BIOFAB Random Promoter apFAB311RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtaggttgtgtgga
BBa_K3702028BIOFAB Random Promoter apFAB279RegulatoryBIOFAB35-1 . . . ctttaatcatcggctcgtataatgtgtgga
BBa_K3702029BIOFAB Random Promoter apFAB314RegulatoryBIOFAB36-1 . . . attaatcatccggctcctaagttgtgtgga
BBa_K3702030BIOFAB Random Promoter apFAB281RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702031BIOFAB Random Promoter apFAB276RegulatoryBIOFAB35-1 . . . tattaatcatcggctcgtataatgtgtgga
BBa_K3702032BIOFAB Random Promoter apFAB312RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagtgtttgtgga
BBa_K3702033BIOFAB Random Promoter apFAB273RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702034BIOFAB Random Promoter apFAB316RegulatoryBIOFAB36-1 . . . attaatcatccggctcatatagtatgtgga
BBa_K3702035BIOFAB Random Promoter apFAB282RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702036BIOFAB Random Promoter apFAB260RegulatoryBIOFAB35-1 . . . tgttaatcatcggctcgtataatgtgtgga
BBa_K3702037BIOFAB Random Promoter apFAB293RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaggttgtgtgga
BBa_K3702038BIOFAB Random Promoter apFAB259RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702039BIOFAB Random Promoter apFAB284RegulatoryBIOFAB36-1 . . . attaatcatccggctcataagttttgtgga
BBa_K3702040BIOFAB Random Promoter apFAB285RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagcctctgtgga
BBa_K3702041BIOFAB Random Promoter apFAB286RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagtttttgtgga
BBa_K3702042BIOFAB Random Promoter apFAB257RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702043BIOFAB Random Promoter apFAB267RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagggtctgtgga
BBa_K3702044BIOFAB Random Promoter apFAB263RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702045BIOFAB Random Promoter apFAB262RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702046BIOFAB Random Promoter apFAB265RegulatoryBIOFAB35-1 . . . tattaatcatcggctcatccattatgtgga
BBa_K3702047BIOFAB Random Promoter apFAB271RegulatoryBIOFAB36-1 . . . attaatcatccggctcttagcgtgtgtgga
BBa_K3702048BIOFAB Random Promoter apFAB278RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702049BIOFAB Random Promoter apFAB241RegulatoryBIOFAB35-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702050BIOFAB Random Promoter apFAB280RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702051BIOFAB Random Promoter apFAB254RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702052BIOFAB Random Promoter apFAB266RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttaggctatgtgga
BBa_K3702053BIOFAB Random Promoter apFAB270RegulatoryBIOFAB35-1 . . . aattaatcatcggctcataaagtgtgtgga
BBa_K3702054BIOFAB Random Promoter apFAB287RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagggtttgtgga
BBa_K3702055BIOFAB Random Promoter apFAB256RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702056BIOFAB Random Promoter apFAB253RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702057BIOFAB Random Promoter apFAB264RegulatoryBIOFAB35-1 . . . ctttaatcatcggctcgtataatgtgtgga
BBa_K3702058BIOFAB Random Promoter apFAB337RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702059BIOFAB Random Promoter apFAB261RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702060BIOFAB Random Promoter apFAB272RegulatoryBIOFAB35-1 . . . aattaatcatcggctcgtagagtttgtgga
BBa_K3702061BIOFAB Random Promoter apFAB274RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702062BIOFAB Random Promoter apFAB258RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagtttctgtgga
BBa_K3702063BIOFAB Random Promoter apFAB255RegulatoryBIOFAB35-1 . . . aattaatcatcggctcgtataatgtgtgga
BBa_K3702064BIOFAB Random Promoter apFAB268RegulatoryBIOFAB36-1 . . . attaatcatccggctcatagcgtgtgtgga
BBa_K3702065BIOFAB Random Promoter apFAB333RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702066BIOFAB Random Promoter apFAB326RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702067BIOFAB Random Promoter apFAB343RegulatoryBIOFAB36-1 . . . attaatcatccggctcatagcgtctgtgga
BBa_K3702068BIOFAB Random Promoter apFAB329RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtatcatatgtgga
BBa_K3702069BIOFAB Random Promoter apFAB332RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702070BIOFAB Random Promoter apFAB252RegulatoryBIOFAB36-1 . . . attaatcatccggctcatatgctttgtgga
BBa_K3702071BIOFAB Random Promoter apFAB251RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaggttctgtgga
BBa_K3702072BIOFAB Random Promoter apFAB226RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatctgtgga
BBa_K3702073BIOFAB Random Promoter apFAB315RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702074BIOFAB Random Promoter apFAB335RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702075BIOFAB Random Promoter apFAB334RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702076BIOFAB Random Promoter apFAB319RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702077BIOFAB Random Promoter apFAB229RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702078BIOFAB Random Promoter apFAB228RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702079BIOFAB Random Promoter apFAB225RegulatoryBIOFAB36-1 . . . gttaatcatccggctcctataatttgtgga
BBa_K3702080BIOFAB Random Promoter apFAB224RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtagagtgtgtgga
BBa_K3702081BIOFAB Random Promoter apFAB324RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttaggctttgtgga
BBa_K3702082BIOFAB Random Promoter apFAB230RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702083BIOFAB Random Promoter apFAB318RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtataatgtgtgga
BBa_K3702084BIOFAB Random Promoter apFAB331RegulatoryBIOFAB36-1 . . . cttaatcatccggctcggagactttgtgga
BBa_K3702085BIOFAB Random Promoter apFAB304RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702086BIOFAB Random Promoter apFAB231RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702087BIOFAB Random Promoter apFAB227RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702088BIOFAB Random Promoter apFAB209RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702089BIOFAB Random Promoter apFAB202RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatctgtgga
BBa_K3702090BIOFAB Random Promoter apFAB212RegulatoryBIOFAB35-1 . . . ttttaatcatcggctcgtataatgtgtgga
BBa_K3702091BIOFAB Random Promoter apFAB211RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702092BIOFAB Random Promoter apFAB221RegulatoryBIOFAB36-1 . . . attaatcatccggctcatagactgtgtgga
BBa_K3702093BIOFAB Random Promoter apFAB205RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtattatatgtgga
BBa_K3702094BIOFAB Random Promoter apFAB201RegulatoryBIOFAB36-1 . . . cttaatcatccggctcctatagtgtgtgga
BBa_K3702095BIOFAB Random Promoter apFAB193RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702096BIOFAB Random Promoter apFAB203RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtagtctgtgtgga
BBa_K3702097BIOFAB Random Promoter apFAB200RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttagggtttgtgga
BBa_K3702098BIOFAB Random Promoter apFAB207RegulatoryBIOFAB36-1 . . . tttaatcatccggctcatatactttgtgga
BBa_K3702099BIOFAB Random Promoter apFAB206RegulatoryBIOFAB36-1 . . . tttaatcatccggctcgtaccctttgtgga
BBa_K3702101BIOFAB Random Promoter apFAB208RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702102BIOFAB Random Promoter apFAB181RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtaaactgtgtgga
BBa_K3702103BIOFAB Random Promoter apFAB204RegulatoryBIOFAB36-1 . . . attaatcatccggctcctagtgtatgtgga
BBa_K3702104BIOFAB Random Promoter apFAB190RegulatoryBIOFAB35-1 . . . cgttaatcatcggctcgtataatgtgtgga
BBa_K3702105BIOFAB Random Promoter apFAB189RegulatoryBIOFAB35-1 . . . ccttaatcatcggctcgtataatgtgtgga
BBa_K3702106BIOFAB Random Promoter apFAB184RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtacgatgtgtgga
BBa_K3702107BIOFAB Random Promoter apFAB215RegulatoryBIOFAB35-1 . . . ggttaatcatcggctcgtataatgtgtgga
BBa_K3702108BIOFAB Random Promoter apFAB168RegulatoryBIOFAB35-1 . . . cctaatcatccggctcgtataatgtgtgga
BBa_K3702109BIOFAB Random Promoter apFAB197RegulatoryBIOFAB35-1 . . . aattaatcatcggctcttaggttttgtgga
BBa_K3702110BIOFAB Random Promoter apFAB199RegulatoryBIOFAB35-1 . . . attaatcatccggctcgtagtgtgtgtgga
BBa_K3702111BIOFAB Random Promoter apFAB216RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702112BIOFAB Random Promoter apFAB180RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtattgtatgtgga
BBa_K3702113BIOFAB Random Promoter apFAB187RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtatagtctgtgga
BBa_K3702114BIOFAB Random Promoter apFAB182RegulatoryBIOFAB36-1 . . . tttaatcatccggctcttaacttgtgtgga
BBa_K3702115BIOFAB Random Promoter apFAB186RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtatgttctgtgga
BBa_K3702116BIOFAB Random Promoter apFAB183RegulatoryBIOFAB36-1 . . . attaatcatccggctcctaggttatgtgga
BBa_K3702117BIOFAB Random Promoter apFAB195RegulatoryBIOFAB36-1 . . . attaatcatccggctcggaaagaatgtgga
BBa_K3702118BIOFAB Random Promoter apFAB167RegulatoryBIOFAB36-1 . . . attaatcatccggctcataaaatttgtgga
BBa_K3702119BIOFAB Random Promoter apFAB177RegulatoryBIOFAB36-1 . . . cttaatcatccggctcaggtgtaatgtgga
BBa_K3702120BIOFAB Random Promoter apFAB192RegulatoryBIOFAB36-1 . . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702121BIOFAB Random Promoter apFAB220RegulatoryBIOFAB35-1 . . . aattaatcatcggctcatatggtctgtgga
BBa_K3702122BIOFAB Random Promoter apFAB161RegulatoryBIOFAB36-1 . . . cttaatcatccggctcttagagtatgtgga
BBa_K3702123BIOFAB Random Promoter apFAB160RegulatoryBIOFAB36-1 . . . cttaatcatccggctcttatagtttgtgga
BBa_K3702124BIOFAB Random Promoter apFAB162RegulatoryBIOFAB36-1 . . . attaatcatccggctcgtagtctgtgtgga
BBa_K3702125BIOFAB Random Promoter apFAB159RegulatoryBIOFAB36-1 . . . gttaatcatccggctcctagcatgtgtgga
BBa_K3702126BIOFAB Random Promoter apFAB164RegulatoryBIOFAB36-1 . . . attaatcatccggctcttaccgtttgtgga
BBa_K3702127BIOFAB Random Promoter apFAB166RegulatoryBIOFAB36-1 . . . cttaatcatctggctcatagtttatgtgga
BBa_K3702128BIOFAB Random Promoter apFAB157RegulatoryBIOFAB36-1 . . . attaatcatccggctcatattttttgtgga
BBa_K3702129BIOFAB Random Promoter apFAB217RegulatoryBIOFAB35-1 . . . aattaatcatcggctcctagggtttgtgga
BBa_K3702130BIOFAB Random Promoter apFAB156RegulatoryBIOFAB36-1 . . . gttaatcatccggctcctagtttgtgtgga
BBa_K3702131BIOFAB Random Promoter apFAB213RegulatoryBIOFAB36-1 . . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702132BIOFAB Random Promoter apFAB325RegulatoryBIOFAB35-1 . . . aattaatatccggctcgtagcgtctgtgga
BBa_K3702133BIOFAB Random Promoter apFAB188RegulatoryBIOFAB35-1 . . . ccttaatcatcggctcgtataatgtgtgga
BBa_K3702134BIOFAB Random Promoter apFAB210RegulatoryBIOFAB35-1 . . . cgttaatcatcggctcgtataatgtgtgga
BBa_K3702135BIOFAB Random Promoter apFAB327RegulatoryBIOFAB36-1 . . . tttaatcatccggctcctactctgtgtgga
BBa_K3702136BIOFAB Random Promoter apFAB294RegulatoryBIOFAB36-1 . . . gttaatcatccggctcataaaatttgtgga

Terminators Table


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K3702161BIOFAB Terminator apFAB376TerminatorBIOFAB34-1 . . . aaaaaccccgcttcggcggggttttttcgc
BBa_K3702173BIOFAB Terminator apFAB388TerminatorBIOFAB39-1 . . . ccccgcccctgacagggcggggtttttttt
BBa_K3702137BIOFAB Terminator apFAB352TerminatorBIOFAB86-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702138BIOFAB Terminator apFAB353TerminatorBIOFAB50-1 . . . atatttcgattgcatgtgcaattttttgca
BBa_K3702139BIOFAB Terminator apFAB354TerminatorBIOFAB33-1 . . . tcgcaaaaaaccccgctggggttttttcgc
BBa_K3702140BIOFAB Terminator apFAB355TerminatorBIOFAB80-1 . . . tgtctattatccctaagcccattttttgca
BBa_K3702141BIOFAB Terminator apFAB356TerminatorBIOFAB121-1 . . . tgcactaagcacataattgctcacagccaa
BBa_K3702142BIOFAB Terminator apFAB357TerminatorBIOFAB52-1 . . . gatacccagcccgcctaatcaatgcaaaca
BBa_K3702143BIOFAB Terminator apFAB358TerminatorBIOFAB31-1 . . . gcaaaaaaccccgctgcggggttttttcgc
BBa_K3702144BIOFAB Terminator apFAB359TerminatorBIOFAB83-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702145BIOFAB Terminator apFAB360TerminatorBIOFAB40-1 . . . tgtctattatccctaagcccattttttgca
BBa_K3702146BIOFAB Terminator apFAB361TerminatorBIOFAB105-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702147BIOFAB Terminator apFAB362TerminatorBIOFAB80-1 . . . cagccgcctgtcgcccgaaggccggtcggc
BBa_K3702148BIOFAB Terminator apFAB363TerminatorBIOFAB91-1 . . . gcgcggttgataacggttcagacaggttta
BBa_K3702149BIOFAB Terminator apFAB364TerminatorBIOFAB102-1 . . . cgataaagaagatttagcttcaaataaaac
BBa_K3702150BIOFAB Terminator apFAB365TerminatorBIOFAB108-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702151BIOFAB Terminator apFAB366TerminatorBIOFAB109-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702152BIOFAB Terminator apFAB367TerminatorBIOFAB83-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702153BIOFAB Terminator apFAB368TerminatorBIOFAB96-1 . . . gcgcggttgataacggttcagacaggttta
BBa_K3702154BIOFAB Terminator apFAB369TerminatorBIOFAB106-1 . . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702155BIOFAB Terminator apFAB370TerminatorBIOFAB97-1 . . . gcgcggttgataacggttcagacaggttta
BBa_K3702156BIOFAB Terminator apFAB371TerminatorBIOFAB93-1 . . . cccccgatgtggcgcagactgatttatcac
BBa_K3702157BIOFAB Terminator apFAB372TerminatorBIOFAB91-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702158BIOFAB Terminator apFAB373TerminatorBIOFAB84-1 . . . attactcaacaggtaaggcgcgaggttttc
BBa_K3702159BIOFAB Terminator apFAB374TerminatorBIOFAB104-1 . . . ttgggtcagtcgtataaaggtcattacgga
BBa_K3702160BIOFAB Terminator apFAB375TerminatorBIOFAB80-1 . . . tcccgatcttaatgaatggccggaagtggt
BBa_K3702162BIOFAB Terminator apFAB377TerminatorBIOFAB91-1 . . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702163BIOFAB Terminator apFAB378TerminatorBIOFAB91-1 . . . caagcagcagattacgcgcagaaaaaaagg
BBa_K3702164BIOFAB Terminator apFAB379TerminatorBIOFAB85-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702165BIOFAB Terminator apFAB380TerminatorBIOFAB85-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702166BIOFAB Terminator apFAB381TerminatorBIOFAB90-1 . . . ttccgggcattaaccctcactaacaggaga
BBa_K3702167BIOFAB Terminator apFAB382TerminatorBIOFAB87-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702168BIOFAB Terminator apFAB383TerminatorBIOFAB88-1 . . . tttataaggagacactttatgtttaagaag
BBa_K3702169BIOFAB Terminator apFAB384TerminatorBIOFAB91-1 . . . atctgttgtttgtcggtgaacgctctcctg
BBa_K3702170BIOFAB Terminator apFAB385TerminatorBIOFAB87-1 . . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702171BIOFAB Terminator apFAB386TerminatorBIOFAB85-1 . . . ggagattttcaacatgaaaaaattattatt
BBa_K3702172BIOFAB Terminator apFAB387TerminatorBIOFAB91-1 . . . atctgttgtttgtcggtgaacgctctcctg
BBa_K3702174BIOFAB Terminator apFAB389TerminatorBIOFAB91-1 . . . atctgttgtttgtcggtgaacactctcccg
BBa_K3702175BIOFAB Terminator apFAB390TerminatorBIOFAB89-1 . . . gaccttaaaaacataaccgaggagcagaca
BBa_K3702176BIOFAB Terminator apFAB391TerminatorBIOFAB82-1 . . . tttggaggggcagaaagatgaatgactgtc