Difference between revisions of "Part:BBa K3767003"

 
Line 3: Line 3:
 
<partinfo>BBa_K3767003 short</partinfo>
 
<partinfo>BBa_K3767003 short</partinfo>
  
−
Alkaline phosphatase coding sequence (no rbs, promoter, or terminator present) from Citrobacter. This bacterium's phoA was chosen due simply to the absense of Biobrick restriction sites. There may be some neutral point mutations relative to the stated sequence, but the construct is fully functional. This part exists in plasmid pSB1A2 (pSB1A2-Bca1032), and in J61003 (pBca1020-Bca1032) under the control of a Tet promoter and RBS b0034.
+
The 3-24 ScFv sequence is composed of light chains (VL) and heavy chains (VH) from antibodies that are linked by a peptide linker (1). The sequence was made to detect the bacteria that result in Lyme Disease, known as Borrelia Burgdorferi using the OspA. The design of the 3-24 ScFv sequence was based on past research done by Ghosh and Huber to optimize its binding affinity to both the OspA and E. coli expression (2). The green fluorescent protein (GFP) is a reporter gene that is derived from the jellyfish Aequeora victoria. It can be used as a marker for gene expression and protein targeting in intact cells due to its extremely visible fluorescence (3). This part is being registered as a composite of a previously registered sequence (BBa_K3767000) and GFP (BBa_E0040).
  
−
The green fluorescent protein (GFP) gene can be used as reporter gene and express in Starmerella bombocola.
+
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
  
−
3-24 ScFv Sequence: GAAGTCCAGTTGGTACAGAGTGGCGCTGAGGTAAAAAAACCGGGAGCAAGTGTTAAAGTCTCTTGCAAAGCCTCGGGTTACACCTTTACAGATTATTATCTCCATTGGGTCCGTCAGGCGCCGGGCCAAGGACTTGAGTGGTTAGGTCGAATTAACCCATCATCCGGTGCAACTTACAGCCCGCAGCGCTTCCAGGGCCGTGTTACTATGACCACTGACACGTCCATATCCACCGCCTATATGGAATTAAGTAGCCTGCGTAGCGACGATACCGCCGTGTACTTTTGTGCCACGCTGACGACCTTTAACATCTGGGCTTTTGACTACTGGGGCCAGGGTACCCTGGTGTCATCTGGCGGTGGTGGGTCGGGCGGTGGTGGAAGCGGCGGCGGCGGATCAAGCGATATTCAAATGACCCAGTCGCCATCGTCTCTGTCCGCGAGCGTGGGCGATCGCGTGACCATTACATGCCGGGCGTCGCAAAGCATCAGTACATATCTGAATTGGTATCAACAGAAACCTGGTAAGGCACCCAAACTGCTGATCTTCACAGCGTCATCGCTTCAATCTGGGGTTCCGAGCACGTTCAGTGGGAGTGGGTCCGGTACTGATTTCACCTTGACGATCAGCTCTCTACAGCCGGAAGATTTCGCTACCTATTACTGTCAGCAGAGCTATTCAGCGACGTTTACGTTTGGCGGGGGCACCAAAGTGGAAATTAAGCGC
+
The green fluorescent protein is a reporter gene that consists of 238 amino acids and has a three amino acid sequence (Ser65-Tyr66-Gly67). It can form a structure to emit a visible green fluorescence when exposed to blue UV light (4). As it is a marker protein, it can use its fluorescence to mark proteins to help allow specific proteins to be identified easily. The structure consists of a beta-sheet polypeptide, an alpha helix polypeptide, an alpha helix, which overall forms a beta barrel shape. A chromophore in the centre is required to emit the fluorescence, which is done through the process of cyclization, dehydration, and oxidation.
  
−
 
+
The three amino acid structure undergoes these steps to produce a structure that contains the fluorescence emitting feature. This has an absorbance wavelength of 397 nm and goes up to 475 nm through deprotonation. A mechanism of the fluorescence process is shown below.
−
<!-- Add more about the biology of this part here
+
−
===Usage and Biology===
+
  
 
<!-- -->
 
<!-- -->

Revision as of 21:18, 4 July 2021


3-24 ScFv sequence linked to Green Fluorescent Protein (GFP)

The 3-24 ScFv sequence is composed of light chains (VL) and heavy chains (VH) from antibodies that are linked by a peptide linker (1). The sequence was made to detect the bacteria that result in Lyme Disease, known as Borrelia Burgdorferi using the OspA. The design of the 3-24 ScFv sequence was based on past research done by Ghosh and Huber to optimize its binding affinity to both the OspA and E. coli expression (2). The green fluorescent protein (GFP) is a reporter gene that is derived from the jellyfish Aequeora victoria. It can be used as a marker for gene expression and protein targeting in intact cells due to its extremely visible fluorescence (3). This part is being registered as a composite of a previously registered sequence (BBa_K3767000) and GFP (BBa_E0040).

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1379